Review



normocin invivogen cat  (InvivoGen)


Bioz Verified Symbol InvivoGen is a verified supplier
Bioz Manufacturer Symbol InvivoGen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    InvivoGen normocin invivogen cat
    Normocin Invivogen Cat, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 2615 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Normocin/pm42213779-414-98-99
    Average 99 stars, based on 2615 article reviews
    normocin invivogen cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    other:

    Article Title: Amphiregulin orchestrates the paracrine immune-suppressive function of amniotic-derived cells through its interplay with COX-2/PGE 2 /EP4 axis.
    Article Snippet: Normocin InvivoGen Cat#ANT-NR-2 Blasticidin InvivoGen Cat#ANT-BL-1 Zeocin InvivoGen Cat#ANT-ZN-1

    Article Title: Multimodal targeting of metastatic renal cell carcinoma via CD70-directed allogeneic CAR-NKT cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human IFN-γ (ELISA, standard) eBioscience CAT#29-8319-65 Human TNF-α (ELISA, standard) eBioscience CAT#29-8329-65 Human IL-2 (ELISA, standard) eBioscience CAT#29-8029-65 Human IL-4 (ELISA, standard) eBioscience CAT#39-8049-65 Human IL-6 (ELISA, standard) eBioscience CAT#29-8069-65 Human IL-15 (ELISA, standard) eBioscience CAT#29-8159-60 Human IL-17A (ELISA, standard) eBioscience CAT#29-8179-65 Mouse IL-6 (ELISA, standard) eBioscience CAT#29-8061-65 Tetramethylbenzidine (TMB) KPL CAT#5120-0053 α-Galactosylceramide (KRN7000) Avanti Polar Lipids SKU#867000P-1mg Recombinant human IL-2 Peprotech CAT#200-02 Recombinant human IL-3 Peprotech CAT#200-03 Recombinant human IL-4 Peprotech CAT#200-04 Recombinant human IL-7 Peprotech CAT#200-07 Recombinant human IL-13 Peprotech CAT#200-13 Recombinant human IL-15 Peprotech CAT#200-15 Recombinant human IL-21 Peprotech CAT#200-21 Recombinant human IFN-γ Peprotech CAT#300-02 Recombinant human Flt3-Ligand Peprotech CAT#300-19 Recombinant human SCF Peprotech CAT#300-07 Recombinant human TPO Peprotech CAT#300-18 Recombinant human GM-CSF Peprotech CAT#300-03 Recombinant human M-CSF Peprotech CAT#300-25 L-ascorbic acid 2-phosphate Sigma CAT#A8960-5G B27TM Supplement (50X), serum free ThermoFisher CAT#17504044 Cas9-NLS purified protein UC Berkeley N/A X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza CAT#04-418Q RPMI1640 cell culture medium Corning Cellgro CAT#10-040-CV DMEM cell culture medium Corning Cellgro CAT#10-013-CV Fetal Bovine Serum (FBS) Sigma CAT#F2442 MACS BSA stock solution Miltenyi CAT#130-091-376 30% BSA Gemini CAT#700-110-100 Penicillin-Streptomycine-Glutamine (P/S/G) Gibco CAT#10378016 Penicillin: streptomycin (pen:strep) solution (P/S) Gemini Bio-products CAT#400-109-100 MEM non-essential amino acids (NEAA) Gibco CAT#11140050 HEPES Buffer Solution Gibco CAT#15630080 Sodium Pyruvate Gibco CAT#11360070 Beta-Mercaptoethanol Sigma SKU#M6250 Normocin Invivogen CAT#ant-nr-2 Fixable Viability Dye eFluor506 eBioscience CAT#65-0866-14 Cell Fixation/Permeabilization Kit BD Biosciences CAT#554714 RetroNectin recombination human fibronectin fragment, 2.5mg Takara CAT#T100B 10% neutral-buffered formalin Richard-Allan Scientific CAT#5705 D-Luciferin Potassium Salt Bioluminescent Substrate Revivi CAT#122799-100MG Fluriso (Isoflurane) Vet One CAT#502017 Phosphate Buffered Saline (PBS) pH 7.4 (1X) Gibco CAT#10010-023 Formaldehyde Sigma-Aldrich CAT#F8775 Golgistop Protein Transport Inhibitor BD Biosciences CAT#554724 (Continued on next page) e3 Cell Reports Medicine 6, 102321, September 16, 2025 Article ll OPEN ACCESS

    Recombinant:


    Article Title: Protocol for generation of and high-throughput drug testing with patient-derived colorectal cancer organoids.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human colorectal cancer tissues This paper N/A Human normal colon tissues This paper N/A Buffy coat from patient blood samples This paper N/A Chemicals, peptides, and recombinant proteins Gibco Advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634028 Gibco DMEM/F12 (containing GlutaMAX) Life Technologies Cat#10565042 GlutaMAX supplement Gibco Cat#35050061 HEPES Sigma-Aldrich Cat#H3375-1KG B-27 supplement Life Technologies Cat#17504001 N2 supplement Life Technologies Cat#17502001 Nicotinamide Sigma-Aldrich Cat#72340-1KG N-acetyl-L-cysteine Sigma-Aldrich Cat#A7250-1KG Recombinant human basic fibroblast growth factor (FGF2) Life Technologies Cat#PHG0263 Recombinant human epidermal growth factor (EGF) Life Technologies Cat#PHG0313 A83-01 Tocris Bioscience Cat#2939 Primocin InvivoGen Cat#ant-pm-2 Y27632 STEMCELL Technologies Cat#72308 Matrigel Corning Cat#356234 Penicillin-streptomycin Life Technologies Cat#15140122 Normocin InvivoGen Catant-nr-2 Gentamicin Thermo Fisher Scientific Cat#15750078 Collagenase IV Life Technologies Cat#17104019 TrypLE Express enzyme Thermo Fisher Scientific Cat#12604021 Tissue-Tek O.C.T Compound Emgrid Cat#4583 Bovine serum albumin (BSA) Merck Cat#A9418 Dulbecco’s phosphate-buffered saline (DPBS) 500 mL Thermo Fisher Scientific Cat#14190136 DMSO Sigma-Aldrich Cat#D4540 CryoStor CS10 medium STEMCELL Technologies Cat# 07930 Trypan blue Thermo Fisher Scientific Cat#15250061 3D CellTiter-Glo Promega Cat#G9683 5FU Selleckchem Cat#S1209 SN-38 Selleckchem Cat#S4908 Oxaliplatin Selleckchem Cat#S1224 Regorafenib Selleckchem Cat#S5077 TAS-102 Selleckchem Cat#S8539 (Continued on next page) 4 STAR Protocols 5, 103090, June 21, 2024 .. Recipes Continued REAGENT or RESOURCE SOURCE IDENTIFIER Gemcitabine Selleckchem Cat#S1149 Pemetrexed Selleckchem Cat#S5971 Temozolomide Selleckchem Cat#S1237 Erlotinib Selleckchem Cat#S7786 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Sigma-Aldrich MP0035-1KT Experimental models: Organisms/strains Patient-derived colorectal cancer organoids This paper N/A Software and algorithms ImageJ software (NIH Image) Schindelin et al.7 https://imagej.nih.gov/ij/ R (version 4.2.0) R Development Core Team8 https://www.R-project.org/ NIS-Elements AR software (version 5.21.03, 64-bit) Nikon N/A Other MANTIS Microfluidic liquid dispenser Formulatrix Cat#0695 JANUS G3 Liquid Handler Workstation PerkinElmer G3 384 PinTool addition accessory PerkinElmer N/A Nikon Eclipse Ti2 inverted microscope system Nikon Eclipse Ti2 Drug stock plate, microplate 384-well, (U)-bottom, polypropylene, low volume, 35 mL, case of 50 PerkinElmer Cat#6008890 MicroClime Environmental lid, COC, SBS fit, sterile, Labcyte Cat#LLS-0310-IP 6-well multiwell plate for suspension cultures Greiner Bio-One Cat#657185 PDTO assay plate, 384-well black/clear bottom plate, non-treated surface Thermo Fisher Scientific Cat#NUN242764 Nunc microplate lids, 384 plates, sterile Thermo Fisher Scientific Cat#264611 70-mm cell strainers Bio-Strategy Cat#BDAA352340 Needle 26G 3 13 mm single use sterile Terumo Australia Cat#AN2613R1 Syringe hypodermic 1 mL tuberculin single use individually wrapped sterile Science Supply Australia Cat#10002122 Filter unit 500 mL 0.2 mm PES 75 mm diameter membrane sterile 12/box Merck Cat#10016724 Filter unit 250 mL 0.2 mm PES 50 mm diameter membrane sterile 12/box Merck Cat#10016723 Filter, PES, 1,000 mL,90 mm, 0.1 mm case of 12 (Nalgene Rapid-Flow sterile disposable filter units with PES membrane, 1,000 mL, 0.1 mm pore, 90 mm membrane) Thermo Fisher Scientific Cat#567-0010 Hemocytometer STEMCELL Technologies Cat#100-1181 Cool cell LX cell freezing container STEMCELL Technologies Cat#200-0644 Tabletop centrifuge Eppendorf Cat#5425R Benchtop centrifuge Eppendorf Cat#5810R Nikon eclipse TS100 microscopy Nikon Eclipse TS100 Tissue collection medium Reagent Final concentration Amount Gentamicin 50 mg/mL 500 mL DMEM/F12+GLUTAMAX N/A 500 mL Total N/A 500 mL [Once prepared, keep at 4 C for up to 6 months] Colorectal cancer organoid primary culture medium Reagent Final concentration Amount Y-27632 (10 mM) 10 mM 500 mL Primocin (50 mg/mL) 100 mg/mL 1 mL (Continued on next page) STAR Protocols 5, 103090, June 21, 2024 5

    Article Title: Longitudinal analysis of the gut microbiota during anti-PD-1 therapy reveals stable microbial features of response in melanoma patients.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MEL-A Dako M7196 PRAME Abcam Cat#Ab219650; RRID:AB_219650 CCR7 BV421 BD Biosciences Cat#150503 CD8 BV605 BD Biosciences Cat#564116; RRID:AB_2869551 CD25 BV786 BD Biosciences Cat#741035; RRID:AB_2740625 CD45RA PE BD Biosciences Cat#561883; RRID:AB_10895572 CD69 APC BD Biosciences Cat#555533; RRID: AB_398602 CD3 APCR700 BD Biosciences Cat#565119; RRID:AB_2744385 CXCR3 PerCP-Cy5.5 BD Biosciences Cat#560832; RRID:AB_2033945 IL17A FITC Invitrogen Cat#11-7179-42 IFNG PE-CF594 BD Biosciences Cat#562392; RRID:AB_11153859 TNFA APC-CY7 BioLegend Cat#502944; RRID:AB_2562870 HLADR BV605 BD Biosciences Cat#562845 TLR5 APCR700 Bio-techne R&D Systems Cat#FAB6704N; RRID:AB_3651878 Biological Samples Fecal and Blood Samples from Patients with Melanoma Istituto Europeo di Oncologia; Istituto Nazionale Tumori IRCCS Fondazione G. Pascale R845/18-IEO 889; 37/22 oss Chemicals, Peptides, and Recombinant Proteins Stool Sample Collection & Stabilization Kit Canvax Cat#SC0012 Bovine Serum Albumin Seqens Cas#1005-70 Goat Serum Invitrogen Cat#10000 C HRP-Secondary Antibody (Anti-Rabbit) Agilent Dako Cat#K4003; RRID:AB_2630375 Aminoethyl Carbazole (AEC) + High Sensitivity Substrate Chromogen Agilent Dako Cat#K3461 Hematoxylin Sigma Cat#MHS 16–500ML RPMI-1640 Euroclone Cat#ECM2001L DMEM Euroclone Cat#ECM0103L FBS Euroclone Cat#ECS0165L Hepes Sigma Cat#H0087 Sodium Pyruvate Euroclone Cat#ECM0742D Pen/Strep Euroclone Cat#ECB3001D Glutamine Euroclone Cat#LOBE17605E Normocin InvivoGen Cat#ant-nr Recombinant Human IL-2 Novartis Cat#CLB-P-476-800-13980 IT Anti-CD28/49d BD Biosciences Cat#347690; RRID:AB_647457 Golgi Plug BD Biosciences Cat#555029 Fixation/Permeabilization Solution Kit BD Biosciences Cat#554714 Cytofix/Cytoperm BD Biosciences Cat#554722 Fixable Viability Stain BV510 BD Biosciences Cat#564406 Purified Custom Peptides GenScript (See Table S7) NA UltraPure Flagellin from Salmonella typhimurium InvivoGen Cat#TLR-STFLA Critical Commercial Assays DNeasy PowerSoil Pro Kit Qiagen Cat#47016 MiSeq Reagent Kit V2 Illumina Cat#MS-102-2003 (Continued on next page) Cell Host & Microbe 32, 2004–2018.e1–e9, November 13, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Nextera XT Index Kit V2 Set A Illumina Cat#FC-131-2001 Qubit dsDNA HS Assay Kit Thermofisher Cat#Q32851 Kapa HiFi HotStart ReadyMix Fisher Scientific Cat#50-196-5299 Human Magnetic Luminex Screening Assay Bio-techne Cat#LXSAHM-23 Deposited Data Raw 16S and/or Shotgun data This paper; Baruch et al.9; Davar et al.10; Routy et al.5; Bjork et al.14 PRJEB61942; PRJNA678737; PRJNA672867; PRJNA928744; PRJEB70966, PRJEB43119 Analyzed Shotgun data Lee et al.8; Bjork et al.14 https://bioconductor.org/packages/ curatedMetagenomicData/ Source code/scripts to analyse the data This paper; Biobakery63 https://github.com/ADGM/ melanoma-longitudinal-paper https://github.com/SegataLab/ preprocessing SILVA 128 database; SILVA 132 database Quast et al.64 https://www.arb-silva.de/fileadmin/ silva_databases/qiime/Silva_128_ release.tgz; https://www.arb-silva.de/ fileadmin/silva_databases/qiime/ Silva_132_release.zip CHOCOPhlAnSGB v202103 database Blanco-Mı́guez et al.65 =https://github.com/biobakery/ humann?tab=readme-ovfile#download-the-chocophlandatabase UniRef90 database Suzek et al.66 https://www.uniprot.org/ Pathway–KO mapping file PICRUSt2 https://github.com/picrust/picrust2/ blob/master/picrust2/default_files/ pathway_mapfiles/KEGG_pathways_ to_KO.tsv KO–pathway mapping file Beghini et al.63 https://github.com/biobakery/humann/ blob/master/humann/data/misc/ map_kegg-pwy_name.txt.gz Experimental models: Cell lines HEK-Blue hTLR5 Invivogen Cat#hkb-htlr5; RRID:CVCL_IM83 Oligonucleotides 16S Amplicon PCR Forward Primer TCGTCGGCAGCGTCAGATGTGTATA AGAGACAGCCTACGGGNGGCWGCAG Illumina NA 16S Amplicon PCR Reverse Primer GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGGACTACHVGGGTATCTAATCC Illumina NA Software and algorithms R version v4.1.1 (2021-08-10) R Core Team67 https://www.r-project.org RStudio v2022.07.2+576 RStudio https://posit.co Inkscape v1.2.2 Inkscape Developers https://inkscape.org/ BioRender BioRender https://www.biorender.com/ qiime2-2018.11; qiime2-2019.7 Bolyen et al.68 https://qiime2.org/ qiime2-2018.11 DADA2 plug-in Callahan et al.69 https://docs.qiime2.org/2018.11/plugins/ available/dada2/index.html qiime2-2019.7 SEPP fragment insertion plug-in; qiime2-2019.7 naive Bayes feature classifier plug-in Janssen et al.70; Bokulich et al.71 https://docs.qiime2.org/2019.7/plugins/ available/fragment-insertion/sepp/; https://docs.qiime2.org/2019.7/plugins/ available/feature-classifier/fitclassifier-naive-bayes/ (Continued on next page) e2 Cell Host & Microbe 32, 2004–2018.e1–e9, November 13, 2024

    Binding Assay:


    Enzyme-linked Immunosorbent Assay:


    Membrane:


    Permeability:


    PAMPA Assay:


    Saline:

    Article Title: Protocol for generation of and high-throughput drug testing with patient-derived colorectal cancer organoids.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human colorectal cancer tissues This paper N/A Human normal colon tissues This paper N/A Buffy coat from patient blood samples This paper N/A Chemicals, peptides, and recombinant proteins Gibco Advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634028 Gibco DMEM/F12 (containing GlutaMAX) Life Technologies Cat#10565042 GlutaMAX supplement Gibco Cat#35050061 HEPES Sigma-Aldrich Cat#H3375-1KG B-27 supplement Life Technologies Cat#17504001 N2 supplement Life Technologies Cat#17502001 Nicotinamide Sigma-Aldrich Cat#72340-1KG N-acetyl-L-cysteine Sigma-Aldrich Cat#A7250-1KG Recombinant human basic fibroblast growth factor (FGF2) Life Technologies Cat#PHG0263 Recombinant human epidermal growth factor (EGF) Life Technologies Cat#PHG0313 A83-01 Tocris Bioscience Cat#2939 Primocin InvivoGen Cat#ant-pm-2 Y27632 STEMCELL Technologies Cat#72308 Matrigel Corning Cat#356234 Penicillin-streptomycin Life Technologies Cat#15140122 Normocin InvivoGen Catant-nr-2 Gentamicin Thermo Fisher Scientific Cat#15750078 Collagenase IV Life Technologies Cat#17104019 TrypLE Express enzyme Thermo Fisher Scientific Cat#12604021 Tissue-Tek O.C.T Compound Emgrid Cat#4583 Bovine serum albumin (BSA) Merck Cat#A9418 Dulbecco’s phosphate-buffered saline (DPBS) 500 mL Thermo Fisher Scientific Cat#14190136 DMSO Sigma-Aldrich Cat#D4540 CryoStor CS10 medium STEMCELL Technologies Cat# 07930 Trypan blue Thermo Fisher Scientific Cat#15250061 3D CellTiter-Glo Promega Cat#G9683 5FU Selleckchem Cat#S1209 SN-38 Selleckchem Cat#S4908 Oxaliplatin Selleckchem Cat#S1224 Regorafenib Selleckchem Cat#S5077 TAS-102 Selleckchem Cat#S8539 (Continued on next page) 4 STAR Protocols 5, 103090, June 21, 2024 .. Recipes Continued REAGENT or RESOURCE SOURCE IDENTIFIER Gemcitabine Selleckchem Cat#S1149 Pemetrexed Selleckchem Cat#S5971 Temozolomide Selleckchem Cat#S1237 Erlotinib Selleckchem Cat#S7786 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Sigma-Aldrich MP0035-1KT Experimental models: Organisms/strains Patient-derived colorectal cancer organoids This paper N/A Software and algorithms ImageJ software (NIH Image) Schindelin et al.7 https://imagej.nih.gov/ij/ R (version 4.2.0) R Development Core Team8 https://www.R-project.org/ NIS-Elements AR software (version 5.21.03, 64-bit) Nikon N/A Other MANTIS Microfluidic liquid dispenser Formulatrix Cat#0695 JANUS G3 Liquid Handler Workstation PerkinElmer G3 384 PinTool addition accessory PerkinElmer N/A Nikon Eclipse Ti2 inverted microscope system Nikon Eclipse Ti2 Drug stock plate, microplate 384-well, (U)-bottom, polypropylene, low volume, 35 mL, case of 50 PerkinElmer Cat#6008890 MicroClime Environmental lid, COC, SBS fit, sterile, Labcyte Cat#LLS-0310-IP 6-well multiwell plate for suspension cultures Greiner Bio-One Cat#657185 PDTO assay plate, 384-well black/clear bottom plate, non-treated surface Thermo Fisher Scientific Cat#NUN242764 Nunc microplate lids, 384 plates, sterile Thermo Fisher Scientific Cat#264611 70-mm cell strainers Bio-Strategy Cat#BDAA352340 Needle 26G 3 13 mm single use sterile Terumo Australia Cat#AN2613R1 Syringe hypodermic 1 mL tuberculin single use individually wrapped sterile Science Supply Australia Cat#10002122 Filter unit 500 mL 0.2 mm PES 75 mm diameter membrane sterile 12/box Merck Cat#10016724 Filter unit 250 mL 0.2 mm PES 50 mm diameter membrane sterile 12/box Merck Cat#10016723 Filter, PES, 1,000 mL,90 mm, 0.1 mm case of 12 (Nalgene Rapid-Flow sterile disposable filter units with PES membrane, 1,000 mL, 0.1 mm pore, 90 mm membrane) Thermo Fisher Scientific Cat#567-0010 Hemocytometer STEMCELL Technologies Cat#100-1181 Cool cell LX cell freezing container STEMCELL Technologies Cat#200-0644 Tabletop centrifuge Eppendorf Cat#5425R Benchtop centrifuge Eppendorf Cat#5810R Nikon eclipse TS100 microscopy Nikon Eclipse TS100 Tissue collection medium Reagent Final concentration Amount Gentamicin 50 mg/mL 500 mL DMEM/F12+GLUTAMAX N/A 500 mL Total N/A 500 mL [Once prepared, keep at 4 C for up to 6 months] Colorectal cancer organoid primary culture medium Reagent Final concentration Amount Y-27632 (10 mM) 10 mM 500 mL Primocin (50 mg/mL) 100 mg/mL 1 mL (Continued on next page) STAR Protocols 5, 103090, June 21, 2024 5

    Transfection:

    Article Title: Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses
    Article Snippet: Antibodies CD14-BV510 Biolegend Cat. # 301842; RRID: AB_2561946 CD3-BV510 Biolegend Cat. # 317332; RRID: AB_2561943 CD56-BV510 Biolegend Cat. # 318340; RRID: AB_2561944 CD19-ECD Beckman Coulter Cat. # IM2708U; RRID: AB_130854 CD21-BV711 BD Cat. # 563163; RRID: AB_2738040 IgA-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-011; RRID: AB_2337895 IgD-PE-Cy7 BD Cat. # 561314; RRID: AB_10642457 IgM-PerCP-Cy5.5 BD Cat. # 561285; RRID: AB_10611998 CD27-Alexa Fluor 488 Biolegend Cat. # 393204; RRID: AB_2750089 CD38-APC-Cy7 Biolegend Cat. # 303534; RRID: AB_2561605 goat anti-human IgG-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-170; RRID: AB_2337902 goat anti-human IgA-Cy3 Jackson Immunoresearch Cat. # 109-166-011; RRID: AB_2337733 Alexa-Fluor-488-conjugated anti-IgG Jackson Immunoresearch Cat. # 109-545-003; RRID: AB_2337831 CC6.29 Rogers et al. (2020) N/A CC6.33 Rogers et al. (2020) N/A L25-dP06E11 Rogers et al. (2020) N/A CC12.23 Rogers et al. (2020) N/A CC12.25 Rogers et al. (2020) N/A anti-MERS-CoV spike primary antibody Sino Biological Cat. # 40069-R723; RRID: AB_2860455 goat anti-rabbit antibody Alexa Fluor 647 Life Technologies Cat. # A21245; RRID: AB_2535813 Anti-His biotin Invitrogen Cat. # MA1-21315-BTIN; RRID: AB_2536983 L9 Wang et al. (2020) N/A Virus strains SARS-CoV-2 Centers for Disease Control and Prevention (CDC) GenBank: MT952134 MERS-CoV Armed Forces Health Surveillance Center GenBank: KC776174 GFP-expressing HCoV-OC43 virus Yewdell lab, NIAID N/A Biological samples COVID-19 convalescent human blood and plasma samples New York Blood Center N/A Plasma/serum samples from mRNA1273 vaccine (Moderna) recipients NIH Clinical Research Center N/A Chemicals, peptides and recombinant proteins HCoV-NL63 spike Sino Biological Cat. # 40604-V08B-B HCoV-229E spike Sino Biological Cat. # 40605-V08B-B HCoV-HKU1 spike Sino Biological Cat. # 40606-V08B HCoV-OC43 spike Bangaru et al. (2022) N/A MERS-CoV spike Bangaru et al. (2022) N/A NL63-CoV spike Sino Biological Cat. # 40604-V08B-B 229E-CoV spike Sino Biological Cat. # 40605-V08B-B HKU1-CoV spike Sino Biological Cat. # 40606-V08B SARS-CoV-2 S2 subunit R&D Systems Cat. # 10594-CV-100 Protein G Elution Buffer Thermo Scientific Cat. # 21004 IL21 Gibco Cat. # PHC0211 (Continued on next page) e1 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 .. R848 Invivogen Cat. # tlrl-r848 Mycozap Lonza Cat. # VZA-2021 Gentamicin Quality Biological Cat. # 120-098-661 GlutaMax Gibco Cat. # 11965-092 Normocin Invivogen Cat. # ant-nr-1 Puromycin Invivogen Cat. # ant-pr-1 Hygromycin B Gold Invivogen Cat. # ant-hg-1 Zeocin Invivogen Cat. # ant-zn-05 Penicillin/Streptomycin Invitrogen Cat. # 15140122 A/Solomon Islands/03/2006 (H1N1) hemagglutinin ectodomain Ekiert et al. (2012) N/A CD4 Crosnier et al. (2013) N/A 2.5 mm streptavidin beads, Yellow, Odd # peaks Spherotech Cat. # SVFA-2552-6K 2.5 mm streptavidin beads, Yellow, Even # peaks Spherotech Cat. # SVFB-2552-6K 2.5 mm streptavidin beads, Pink, Odd # peaks Spherotech Cat. # SVFA-2558-6K 2.5 mm streptavidin beads, Pink, Even # peaks Spherotech Cat. # SVFB-2558-6K 7 mm streptavidin beads Spherotech Cat. # SVP-60-5 Lipofectamine 2000 ThermoFisher Scientific Cat. # 11668019 Lipofectamine 3000 transfection reagent ThermoFisher Scientific Cat. # L3000-001 Lyophilized 15-mer peptides JPT Peptide Technologies N/A Horseradish peroxidase Invitrogen Cat. # A18817 POD substrate Roche Cat. # 11582950001 Dynabeads mRNA DIRECT lysis buffer Life Technologies Cat. # 61011 HyClone insect cell culture medium GE Healthcare Cat. # SH30280.03 PEIMax Polysciences Cat. # 24765-1 QUANTI-Blue Solution Invivogen Cat. # rep-qbs Critical commercial assays Bac-to-Bac system Life Technologies Cat. # 10359016 Bright-Glo Luciferase Assay System Promega Cat. # E2620 ScisGo -HLA-v6 kit Scisco Genetics Inc. Cat. # HLA-24S-v6 Pierce Fab Preparation kit ThermoFisher Scientific Cat. # 44985 ExpiCHO expression system ThermoFisher Scientific Cat. # A29133 Expi293F expression system ThermoFisher Scientific Cat. # A14635 ExpiFectamine 293 Transfection Kit ThermoFisher Scientific Cat. # A14524 Deposited data Mouse Hepatitis Virus UniProt UniProt: P11224 HCoV-OC43 UniProt UniProt: P36334 HCoV-HKU1 N5 UniProt UniProt: Q0ZME7 BatCoV-HKU3 UniProt UniProt: Q3LZX1 BatCoV-RaTG13 GenBank GenBank: QHR63300 BatCoV-Rs4231 GenBank GenBank: ATO98157 BatCoV-Rs3367 GenBank GenBank: AGZ48818 BatCoV-WIV1 GenBank GenBank: AGZ48831 Civet-SARS-CoV-007/004 GenBank GenBank: AAU04646 Pangolin-CoV-GX-P2V GenBank GenBank: QIQ54048 SARS-CoV-1-Tor2 GenBank GenBank: AAP41037 SARS-CoV-1-Urbani GenBank GenBank: AAP13441 SARS-CoV-2 Wuhan-Hu-1 GenBank GenBank: YP_009724390 B.1.1.7 GenBank GenBank: QWE88920 B.1.351 GenBank GenBank: QRN78347 (Continued on next page) ll OPEN ACCESSArticle Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 e2 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010 .. P.1 GenBank GenBank: QVE55289 B.1.617.2 GenBank GenBank: QWK65230 BA.1 GenBank GenBank: UFO69279 BA.2 GenBank GenBank: UJE45220 BA.2.75 GenBank GenBank: UTM82166.1 BA.5 GenBank GenBank: UOZ45804.1 Bat-CoV-HKU4 UniProt UniProt: A3EX94 BatCoV-HKU5 GenBank GenBank: YP_001039962.1 MERS-EMC/2012 GenBank GenBank: YP_009047204 BatCoV-GCCDC1 GenBank GenBank: YP_009273005.1 BtRt-BetaCoV/GX2018 GenBank GenBank: QJX58383.1 BatCoV-HKU9 GenBank GenBank: ABN10911 Bat Hp-betacoronavirus/Zhejiang2013 GenBank GenBank: YP_009072440 SARS-CoV-2 GenBank GenBank: QHD43416.1 SARS-CoV GenBank GenBank: AAP13441.1 MERS-CoV GenBank GenBank: AFS88936 HCoV-NL63 GenBank GenBank: Q6Q1S2.1 MesAur1.0 genome assembly GenBank GenBank: GCA_00349664.1 Stem helix-specific mAbs GenBank GenBank: OP377774-OP377795 COV30-14 crystal structure PDB PDB: 8DTR COV89-22 crystal structure PDB PDB: 8DTX COV93-03 crystal structure PDB PDB: 8DTT Experimental models: cell lines Sf9 cells ATCC Cat. # CRL-1711; RRID: CVCL_0549 High Five cells ThermoFisher Scientific Cat. # B85502; RRID: CVCL_C190 FreeStyle 293-F cells ThermoFisher Scientific Cat. # R79007; RRID: CVCL_D603 Irradiated 3T3-CD40L cells Huang et al. (2013) N/A HeLa cells ATCC Cat. # CCL-2; RRID: CVCL_0030 Rhabdomyosarcoma cells ATCC Cat. # CCL136 VRC8400 cells Barouch et al. (2005) N/A HEK-293T cells ATCC Cat. # CRL-11268; RRID: CVCL_1926 293 flpin-TMPRSS2-ACE2 cells Dr. Adrian Creanga, VRC/NIH; Zhou et al. (2022c) N/A Huh7.5 cells Dr. Deborah Taylor, US FDA; Wang et al. (2015) N/A Expi293 cells Gibco Cat. # A14527; RRID: CVCL_D615 Vero E6 cells Expasy CVCL_XD71 Cat. # BEI NR-596; RRID: CVCL_XD71 HEK-Blue hACE2-TMPRSS2 cells Invivogen Cat. # hkb-hace2tpsa 293-hMyD88 cells Invivogen Cat. # 293-hmyd Oligonucleotides PCR primers for amplification of antibody heavy, kappa, and lambda genes Wang et al. (2020) GenBank: MT811859 – MT811914 PCR primers for generation of virus F1148, L1152 and F1156 mutants Table S3 (this study) N/A Experimental models: organisms Golden Syrian Hamsters Envigo (Indianapolis, IN USA) N/A Recombinant DNA pCMV-dR82 dvpr (AssayScripps) Addgene Cat. # 8455; RRID: Addgene_8455 pBOBI-FLuc (AssayScripps) Addgene Cat. # 170674; RRID: Addgene_170674 SARS-CoV (AssayScripps) Addgene Cat. # 170447; RRID: Addgene_170447 (Continued on next page) ll OPEN ACCESS Article e3 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010

    Lysis:

    Article Title: Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses
    Article Snippet: Antibodies CD14-BV510 Biolegend Cat. # 301842; RRID: AB_2561946 CD3-BV510 Biolegend Cat. # 317332; RRID: AB_2561943 CD56-BV510 Biolegend Cat. # 318340; RRID: AB_2561944 CD19-ECD Beckman Coulter Cat. # IM2708U; RRID: AB_130854 CD21-BV711 BD Cat. # 563163; RRID: AB_2738040 IgA-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-011; RRID: AB_2337895 IgD-PE-Cy7 BD Cat. # 561314; RRID: AB_10642457 IgM-PerCP-Cy5.5 BD Cat. # 561285; RRID: AB_10611998 CD27-Alexa Fluor 488 Biolegend Cat. # 393204; RRID: AB_2750089 CD38-APC-Cy7 Biolegend Cat. # 303534; RRID: AB_2561605 goat anti-human IgG-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-170; RRID: AB_2337902 goat anti-human IgA-Cy3 Jackson Immunoresearch Cat. # 109-166-011; RRID: AB_2337733 Alexa-Fluor-488-conjugated anti-IgG Jackson Immunoresearch Cat. # 109-545-003; RRID: AB_2337831 CC6.29 Rogers et al. (2020) N/A CC6.33 Rogers et al. (2020) N/A L25-dP06E11 Rogers et al. (2020) N/A CC12.23 Rogers et al. (2020) N/A CC12.25 Rogers et al. (2020) N/A anti-MERS-CoV spike primary antibody Sino Biological Cat. # 40069-R723; RRID: AB_2860455 goat anti-rabbit antibody Alexa Fluor 647 Life Technologies Cat. # A21245; RRID: AB_2535813 Anti-His biotin Invitrogen Cat. # MA1-21315-BTIN; RRID: AB_2536983 L9 Wang et al. (2020) N/A Virus strains SARS-CoV-2 Centers for Disease Control and Prevention (CDC) GenBank: MT952134 MERS-CoV Armed Forces Health Surveillance Center GenBank: KC776174 GFP-expressing HCoV-OC43 virus Yewdell lab, NIAID N/A Biological samples COVID-19 convalescent human blood and plasma samples New York Blood Center N/A Plasma/serum samples from mRNA1273 vaccine (Moderna) recipients NIH Clinical Research Center N/A Chemicals, peptides and recombinant proteins HCoV-NL63 spike Sino Biological Cat. # 40604-V08B-B HCoV-229E spike Sino Biological Cat. # 40605-V08B-B HCoV-HKU1 spike Sino Biological Cat. # 40606-V08B HCoV-OC43 spike Bangaru et al. (2022) N/A MERS-CoV spike Bangaru et al. (2022) N/A NL63-CoV spike Sino Biological Cat. # 40604-V08B-B 229E-CoV spike Sino Biological Cat. # 40605-V08B-B HKU1-CoV spike Sino Biological Cat. # 40606-V08B SARS-CoV-2 S2 subunit R&D Systems Cat. # 10594-CV-100 Protein G Elution Buffer Thermo Scientific Cat. # 21004 IL21 Gibco Cat. # PHC0211 (Continued on next page) e1 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 .. R848 Invivogen Cat. # tlrl-r848 Mycozap Lonza Cat. # VZA-2021 Gentamicin Quality Biological Cat. # 120-098-661 GlutaMax Gibco Cat. # 11965-092 Normocin Invivogen Cat. # ant-nr-1 Puromycin Invivogen Cat. # ant-pr-1 Hygromycin B Gold Invivogen Cat. # ant-hg-1 Zeocin Invivogen Cat. # ant-zn-05 Penicillin/Streptomycin Invitrogen Cat. # 15140122 A/Solomon Islands/03/2006 (H1N1) hemagglutinin ectodomain Ekiert et al. (2012) N/A CD4 Crosnier et al. (2013) N/A 2.5 mm streptavidin beads, Yellow, Odd # peaks Spherotech Cat. # SVFA-2552-6K 2.5 mm streptavidin beads, Yellow, Even # peaks Spherotech Cat. # SVFB-2552-6K 2.5 mm streptavidin beads, Pink, Odd # peaks Spherotech Cat. # SVFA-2558-6K 2.5 mm streptavidin beads, Pink, Even # peaks Spherotech Cat. # SVFB-2558-6K 7 mm streptavidin beads Spherotech Cat. # SVP-60-5 Lipofectamine 2000 ThermoFisher Scientific Cat. # 11668019 Lipofectamine 3000 transfection reagent ThermoFisher Scientific Cat. # L3000-001 Lyophilized 15-mer peptides JPT Peptide Technologies N/A Horseradish peroxidase Invitrogen Cat. # A18817 POD substrate Roche Cat. # 11582950001 Dynabeads mRNA DIRECT lysis buffer Life Technologies Cat. # 61011 HyClone insect cell culture medium GE Healthcare Cat. # SH30280.03 PEIMax Polysciences Cat. # 24765-1 QUANTI-Blue Solution Invivogen Cat. # rep-qbs Critical commercial assays Bac-to-Bac system Life Technologies Cat. # 10359016 Bright-Glo Luciferase Assay System Promega Cat. # E2620 ScisGo -HLA-v6 kit Scisco Genetics Inc. Cat. # HLA-24S-v6 Pierce Fab Preparation kit ThermoFisher Scientific Cat. # 44985 ExpiCHO expression system ThermoFisher Scientific Cat. # A29133 Expi293F expression system ThermoFisher Scientific Cat. # A14635 ExpiFectamine 293 Transfection Kit ThermoFisher Scientific Cat. # A14524 Deposited data Mouse Hepatitis Virus UniProt UniProt: P11224 HCoV-OC43 UniProt UniProt: P36334 HCoV-HKU1 N5 UniProt UniProt: Q0ZME7 BatCoV-HKU3 UniProt UniProt: Q3LZX1 BatCoV-RaTG13 GenBank GenBank: QHR63300 BatCoV-Rs4231 GenBank GenBank: ATO98157 BatCoV-Rs3367 GenBank GenBank: AGZ48818 BatCoV-WIV1 GenBank GenBank: AGZ48831 Civet-SARS-CoV-007/004 GenBank GenBank: AAU04646 Pangolin-CoV-GX-P2V GenBank GenBank: QIQ54048 SARS-CoV-1-Tor2 GenBank GenBank: AAP41037 SARS-CoV-1-Urbani GenBank GenBank: AAP13441 SARS-CoV-2 Wuhan-Hu-1 GenBank GenBank: YP_009724390 B.1.1.7 GenBank GenBank: QWE88920 B.1.351 GenBank GenBank: QRN78347 (Continued on next page) ll OPEN ACCESSArticle Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 e2 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010 .. P.1 GenBank GenBank: QVE55289 B.1.617.2 GenBank GenBank: QWK65230 BA.1 GenBank GenBank: UFO69279 BA.2 GenBank GenBank: UJE45220 BA.2.75 GenBank GenBank: UTM82166.1 BA.5 GenBank GenBank: UOZ45804.1 Bat-CoV-HKU4 UniProt UniProt: A3EX94 BatCoV-HKU5 GenBank GenBank: YP_001039962.1 MERS-EMC/2012 GenBank GenBank: YP_009047204 BatCoV-GCCDC1 GenBank GenBank: YP_009273005.1 BtRt-BetaCoV/GX2018 GenBank GenBank: QJX58383.1 BatCoV-HKU9 GenBank GenBank: ABN10911 Bat Hp-betacoronavirus/Zhejiang2013 GenBank GenBank: YP_009072440 SARS-CoV-2 GenBank GenBank: QHD43416.1 SARS-CoV GenBank GenBank: AAP13441.1 MERS-CoV GenBank GenBank: AFS88936 HCoV-NL63 GenBank GenBank: Q6Q1S2.1 MesAur1.0 genome assembly GenBank GenBank: GCA_00349664.1 Stem helix-specific mAbs GenBank GenBank: OP377774-OP377795 COV30-14 crystal structure PDB PDB: 8DTR COV89-22 crystal structure PDB PDB: 8DTX COV93-03 crystal structure PDB PDB: 8DTT Experimental models: cell lines Sf9 cells ATCC Cat. # CRL-1711; RRID: CVCL_0549 High Five cells ThermoFisher Scientific Cat. # B85502; RRID: CVCL_C190 FreeStyle 293-F cells ThermoFisher Scientific Cat. # R79007; RRID: CVCL_D603 Irradiated 3T3-CD40L cells Huang et al. (2013) N/A HeLa cells ATCC Cat. # CCL-2; RRID: CVCL_0030 Rhabdomyosarcoma cells ATCC Cat. # CCL136 VRC8400 cells Barouch et al. (2005) N/A HEK-293T cells ATCC Cat. # CRL-11268; RRID: CVCL_1926 293 flpin-TMPRSS2-ACE2 cells Dr. Adrian Creanga, VRC/NIH; Zhou et al. (2022c) N/A Huh7.5 cells Dr. Deborah Taylor, US FDA; Wang et al. (2015) N/A Expi293 cells Gibco Cat. # A14527; RRID: CVCL_D615 Vero E6 cells Expasy CVCL_XD71 Cat. # BEI NR-596; RRID: CVCL_XD71 HEK-Blue hACE2-TMPRSS2 cells Invivogen Cat. # hkb-hace2tpsa 293-hMyD88 cells Invivogen Cat. # 293-hmyd Oligonucleotides PCR primers for amplification of antibody heavy, kappa, and lambda genes Wang et al. (2020) GenBank: MT811859 – MT811914 PCR primers for generation of virus F1148, L1152 and F1156 mutants Table S3 (this study) N/A Experimental models: organisms Golden Syrian Hamsters Envigo (Indianapolis, IN USA) N/A Recombinant DNA pCMV-dR82 dvpr (AssayScripps) Addgene Cat. # 8455; RRID: Addgene_8455 pBOBI-FLuc (AssayScripps) Addgene Cat. # 170674; RRID: Addgene_170674 SARS-CoV (AssayScripps) Addgene Cat. # 170447; RRID: Addgene_170447 (Continued on next page) ll OPEN ACCESS Article e3 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010

    Cell Culture:

    Article Title: Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses
    Article Snippet: Antibodies CD14-BV510 Biolegend Cat. # 301842; RRID: AB_2561946 CD3-BV510 Biolegend Cat. # 317332; RRID: AB_2561943 CD56-BV510 Biolegend Cat. # 318340; RRID: AB_2561944 CD19-ECD Beckman Coulter Cat. # IM2708U; RRID: AB_130854 CD21-BV711 BD Cat. # 563163; RRID: AB_2738040 IgA-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-011; RRID: AB_2337895 IgD-PE-Cy7 BD Cat. # 561314; RRID: AB_10642457 IgM-PerCP-Cy5.5 BD Cat. # 561285; RRID: AB_10611998 CD27-Alexa Fluor 488 Biolegend Cat. # 393204; RRID: AB_2750089 CD38-APC-Cy7 Biolegend Cat. # 303534; RRID: AB_2561605 goat anti-human IgG-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-170; RRID: AB_2337902 goat anti-human IgA-Cy3 Jackson Immunoresearch Cat. # 109-166-011; RRID: AB_2337733 Alexa-Fluor-488-conjugated anti-IgG Jackson Immunoresearch Cat. # 109-545-003; RRID: AB_2337831 CC6.29 Rogers et al. (2020) N/A CC6.33 Rogers et al. (2020) N/A L25-dP06E11 Rogers et al. (2020) N/A CC12.23 Rogers et al. (2020) N/A CC12.25 Rogers et al. (2020) N/A anti-MERS-CoV spike primary antibody Sino Biological Cat. # 40069-R723; RRID: AB_2860455 goat anti-rabbit antibody Alexa Fluor 647 Life Technologies Cat. # A21245; RRID: AB_2535813 Anti-His biotin Invitrogen Cat. # MA1-21315-BTIN; RRID: AB_2536983 L9 Wang et al. (2020) N/A Virus strains SARS-CoV-2 Centers for Disease Control and Prevention (CDC) GenBank: MT952134 MERS-CoV Armed Forces Health Surveillance Center GenBank: KC776174 GFP-expressing HCoV-OC43 virus Yewdell lab, NIAID N/A Biological samples COVID-19 convalescent human blood and plasma samples New York Blood Center N/A Plasma/serum samples from mRNA1273 vaccine (Moderna) recipients NIH Clinical Research Center N/A Chemicals, peptides and recombinant proteins HCoV-NL63 spike Sino Biological Cat. # 40604-V08B-B HCoV-229E spike Sino Biological Cat. # 40605-V08B-B HCoV-HKU1 spike Sino Biological Cat. # 40606-V08B HCoV-OC43 spike Bangaru et al. (2022) N/A MERS-CoV spike Bangaru et al. (2022) N/A NL63-CoV spike Sino Biological Cat. # 40604-V08B-B 229E-CoV spike Sino Biological Cat. # 40605-V08B-B HKU1-CoV spike Sino Biological Cat. # 40606-V08B SARS-CoV-2 S2 subunit R&D Systems Cat. # 10594-CV-100 Protein G Elution Buffer Thermo Scientific Cat. # 21004 IL21 Gibco Cat. # PHC0211 (Continued on next page) e1 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 .. R848 Invivogen Cat. # tlrl-r848 Mycozap Lonza Cat. # VZA-2021 Gentamicin Quality Biological Cat. # 120-098-661 GlutaMax Gibco Cat. # 11965-092 Normocin Invivogen Cat. # ant-nr-1 Puromycin Invivogen Cat. # ant-pr-1 Hygromycin B Gold Invivogen Cat. # ant-hg-1 Zeocin Invivogen Cat. # ant-zn-05 Penicillin/Streptomycin Invitrogen Cat. # 15140122 A/Solomon Islands/03/2006 (H1N1) hemagglutinin ectodomain Ekiert et al. (2012) N/A CD4 Crosnier et al. (2013) N/A 2.5 mm streptavidin beads, Yellow, Odd # peaks Spherotech Cat. # SVFA-2552-6K 2.5 mm streptavidin beads, Yellow, Even # peaks Spherotech Cat. # SVFB-2552-6K 2.5 mm streptavidin beads, Pink, Odd # peaks Spherotech Cat. # SVFA-2558-6K 2.5 mm streptavidin beads, Pink, Even # peaks Spherotech Cat. # SVFB-2558-6K 7 mm streptavidin beads Spherotech Cat. # SVP-60-5 Lipofectamine 2000 ThermoFisher Scientific Cat. # 11668019 Lipofectamine 3000 transfection reagent ThermoFisher Scientific Cat. # L3000-001 Lyophilized 15-mer peptides JPT Peptide Technologies N/A Horseradish peroxidase Invitrogen Cat. # A18817 POD substrate Roche Cat. # 11582950001 Dynabeads mRNA DIRECT lysis buffer Life Technologies Cat. # 61011 HyClone insect cell culture medium GE Healthcare Cat. # SH30280.03 PEIMax Polysciences Cat. # 24765-1 QUANTI-Blue Solution Invivogen Cat. # rep-qbs Critical commercial assays Bac-to-Bac system Life Technologies Cat. # 10359016 Bright-Glo Luciferase Assay System Promega Cat. # E2620 ScisGo -HLA-v6 kit Scisco Genetics Inc. Cat. # HLA-24S-v6 Pierce Fab Preparation kit ThermoFisher Scientific Cat. # 44985 ExpiCHO expression system ThermoFisher Scientific Cat. # A29133 Expi293F expression system ThermoFisher Scientific Cat. # A14635 ExpiFectamine 293 Transfection Kit ThermoFisher Scientific Cat. # A14524 Deposited data Mouse Hepatitis Virus UniProt UniProt: P11224 HCoV-OC43 UniProt UniProt: P36334 HCoV-HKU1 N5 UniProt UniProt: Q0ZME7 BatCoV-HKU3 UniProt UniProt: Q3LZX1 BatCoV-RaTG13 GenBank GenBank: QHR63300 BatCoV-Rs4231 GenBank GenBank: ATO98157 BatCoV-Rs3367 GenBank GenBank: AGZ48818 BatCoV-WIV1 GenBank GenBank: AGZ48831 Civet-SARS-CoV-007/004 GenBank GenBank: AAU04646 Pangolin-CoV-GX-P2V GenBank GenBank: QIQ54048 SARS-CoV-1-Tor2 GenBank GenBank: AAP41037 SARS-CoV-1-Urbani GenBank GenBank: AAP13441 SARS-CoV-2 Wuhan-Hu-1 GenBank GenBank: YP_009724390 B.1.1.7 GenBank GenBank: QWE88920 B.1.351 GenBank GenBank: QRN78347 (Continued on next page) ll OPEN ACCESSArticle Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 e2 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010 .. P.1 GenBank GenBank: QVE55289 B.1.617.2 GenBank GenBank: QWK65230 BA.1 GenBank GenBank: UFO69279 BA.2 GenBank GenBank: UJE45220 BA.2.75 GenBank GenBank: UTM82166.1 BA.5 GenBank GenBank: UOZ45804.1 Bat-CoV-HKU4 UniProt UniProt: A3EX94 BatCoV-HKU5 GenBank GenBank: YP_001039962.1 MERS-EMC/2012 GenBank GenBank: YP_009047204 BatCoV-GCCDC1 GenBank GenBank: YP_009273005.1 BtRt-BetaCoV/GX2018 GenBank GenBank: QJX58383.1 BatCoV-HKU9 GenBank GenBank: ABN10911 Bat Hp-betacoronavirus/Zhejiang2013 GenBank GenBank: YP_009072440 SARS-CoV-2 GenBank GenBank: QHD43416.1 SARS-CoV GenBank GenBank: AAP13441.1 MERS-CoV GenBank GenBank: AFS88936 HCoV-NL63 GenBank GenBank: Q6Q1S2.1 MesAur1.0 genome assembly GenBank GenBank: GCA_00349664.1 Stem helix-specific mAbs GenBank GenBank: OP377774-OP377795 COV30-14 crystal structure PDB PDB: 8DTR COV89-22 crystal structure PDB PDB: 8DTX COV93-03 crystal structure PDB PDB: 8DTT Experimental models: cell lines Sf9 cells ATCC Cat. # CRL-1711; RRID: CVCL_0549 High Five cells ThermoFisher Scientific Cat. # B85502; RRID: CVCL_C190 FreeStyle 293-F cells ThermoFisher Scientific Cat. # R79007; RRID: CVCL_D603 Irradiated 3T3-CD40L cells Huang et al. (2013) N/A HeLa cells ATCC Cat. # CCL-2; RRID: CVCL_0030 Rhabdomyosarcoma cells ATCC Cat. # CCL136 VRC8400 cells Barouch et al. (2005) N/A HEK-293T cells ATCC Cat. # CRL-11268; RRID: CVCL_1926 293 flpin-TMPRSS2-ACE2 cells Dr. Adrian Creanga, VRC/NIH; Zhou et al. (2022c) N/A Huh7.5 cells Dr. Deborah Taylor, US FDA; Wang et al. (2015) N/A Expi293 cells Gibco Cat. # A14527; RRID: CVCL_D615 Vero E6 cells Expasy CVCL_XD71 Cat. # BEI NR-596; RRID: CVCL_XD71 HEK-Blue hACE2-TMPRSS2 cells Invivogen Cat. # hkb-hace2tpsa 293-hMyD88 cells Invivogen Cat. # 293-hmyd Oligonucleotides PCR primers for amplification of antibody heavy, kappa, and lambda genes Wang et al. (2020) GenBank: MT811859 – MT811914 PCR primers for generation of virus F1148, L1152 and F1156 mutants Table S3 (this study) N/A Experimental models: organisms Golden Syrian Hamsters Envigo (Indianapolis, IN USA) N/A Recombinant DNA pCMV-dR82 dvpr (AssayScripps) Addgene Cat. # 8455; RRID: Addgene_8455 pBOBI-FLuc (AssayScripps) Addgene Cat. # 170674; RRID: Addgene_170674 SARS-CoV (AssayScripps) Addgene Cat. # 170447; RRID: Addgene_170447 (Continued on next page) ll OPEN ACCESS Article e3 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010

    Luciferase:

    Article Title: Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses
    Article Snippet: Antibodies CD14-BV510 Biolegend Cat. # 301842; RRID: AB_2561946 CD3-BV510 Biolegend Cat. # 317332; RRID: AB_2561943 CD56-BV510 Biolegend Cat. # 318340; RRID: AB_2561944 CD19-ECD Beckman Coulter Cat. # IM2708U; RRID: AB_130854 CD21-BV711 BD Cat. # 563163; RRID: AB_2738040 IgA-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-011; RRID: AB_2337895 IgD-PE-Cy7 BD Cat. # 561314; RRID: AB_10642457 IgM-PerCP-Cy5.5 BD Cat. # 561285; RRID: AB_10611998 CD27-Alexa Fluor 488 Biolegend Cat. # 393204; RRID: AB_2750089 CD38-APC-Cy7 Biolegend Cat. # 303534; RRID: AB_2561605 goat anti-human IgG-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-170; RRID: AB_2337902 goat anti-human IgA-Cy3 Jackson Immunoresearch Cat. # 109-166-011; RRID: AB_2337733 Alexa-Fluor-488-conjugated anti-IgG Jackson Immunoresearch Cat. # 109-545-003; RRID: AB_2337831 CC6.29 Rogers et al. (2020) N/A CC6.33 Rogers et al. (2020) N/A L25-dP06E11 Rogers et al. (2020) N/A CC12.23 Rogers et al. (2020) N/A CC12.25 Rogers et al. (2020) N/A anti-MERS-CoV spike primary antibody Sino Biological Cat. # 40069-R723; RRID: AB_2860455 goat anti-rabbit antibody Alexa Fluor 647 Life Technologies Cat. # A21245; RRID: AB_2535813 Anti-His biotin Invitrogen Cat. # MA1-21315-BTIN; RRID: AB_2536983 L9 Wang et al. (2020) N/A Virus strains SARS-CoV-2 Centers for Disease Control and Prevention (CDC) GenBank: MT952134 MERS-CoV Armed Forces Health Surveillance Center GenBank: KC776174 GFP-expressing HCoV-OC43 virus Yewdell lab, NIAID N/A Biological samples COVID-19 convalescent human blood and plasma samples New York Blood Center N/A Plasma/serum samples from mRNA1273 vaccine (Moderna) recipients NIH Clinical Research Center N/A Chemicals, peptides and recombinant proteins HCoV-NL63 spike Sino Biological Cat. # 40604-V08B-B HCoV-229E spike Sino Biological Cat. # 40605-V08B-B HCoV-HKU1 spike Sino Biological Cat. # 40606-V08B HCoV-OC43 spike Bangaru et al. (2022) N/A MERS-CoV spike Bangaru et al. (2022) N/A NL63-CoV spike Sino Biological Cat. # 40604-V08B-B 229E-CoV spike Sino Biological Cat. # 40605-V08B-B HKU1-CoV spike Sino Biological Cat. # 40606-V08B SARS-CoV-2 S2 subunit R&D Systems Cat. # 10594-CV-100 Protein G Elution Buffer Thermo Scientific Cat. # 21004 IL21 Gibco Cat. # PHC0211 (Continued on next page) e1 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 .. R848 Invivogen Cat. # tlrl-r848 Mycozap Lonza Cat. # VZA-2021 Gentamicin Quality Biological Cat. # 120-098-661 GlutaMax Gibco Cat. # 11965-092 Normocin Invivogen Cat. # ant-nr-1 Puromycin Invivogen Cat. # ant-pr-1 Hygromycin B Gold Invivogen Cat. # ant-hg-1 Zeocin Invivogen Cat. # ant-zn-05 Penicillin/Streptomycin Invitrogen Cat. # 15140122 A/Solomon Islands/03/2006 (H1N1) hemagglutinin ectodomain Ekiert et al. (2012) N/A CD4 Crosnier et al. (2013) N/A 2.5 mm streptavidin beads, Yellow, Odd # peaks Spherotech Cat. # SVFA-2552-6K 2.5 mm streptavidin beads, Yellow, Even # peaks Spherotech Cat. # SVFB-2552-6K 2.5 mm streptavidin beads, Pink, Odd # peaks Spherotech Cat. # SVFA-2558-6K 2.5 mm streptavidin beads, Pink, Even # peaks Spherotech Cat. # SVFB-2558-6K 7 mm streptavidin beads Spherotech Cat. # SVP-60-5 Lipofectamine 2000 ThermoFisher Scientific Cat. # 11668019 Lipofectamine 3000 transfection reagent ThermoFisher Scientific Cat. # L3000-001 Lyophilized 15-mer peptides JPT Peptide Technologies N/A Horseradish peroxidase Invitrogen Cat. # A18817 POD substrate Roche Cat. # 11582950001 Dynabeads mRNA DIRECT lysis buffer Life Technologies Cat. # 61011 HyClone insect cell culture medium GE Healthcare Cat. # SH30280.03 PEIMax Polysciences Cat. # 24765-1 QUANTI-Blue Solution Invivogen Cat. # rep-qbs Critical commercial assays Bac-to-Bac system Life Technologies Cat. # 10359016 Bright-Glo Luciferase Assay System Promega Cat. # E2620 ScisGo -HLA-v6 kit Scisco Genetics Inc. Cat. # HLA-24S-v6 Pierce Fab Preparation kit ThermoFisher Scientific Cat. # 44985 ExpiCHO expression system ThermoFisher Scientific Cat. # A29133 Expi293F expression system ThermoFisher Scientific Cat. # A14635 ExpiFectamine 293 Transfection Kit ThermoFisher Scientific Cat. # A14524 Deposited data Mouse Hepatitis Virus UniProt UniProt: P11224 HCoV-OC43 UniProt UniProt: P36334 HCoV-HKU1 N5 UniProt UniProt: Q0ZME7 BatCoV-HKU3 UniProt UniProt: Q3LZX1 BatCoV-RaTG13 GenBank GenBank: QHR63300 BatCoV-Rs4231 GenBank GenBank: ATO98157 BatCoV-Rs3367 GenBank GenBank: AGZ48818 BatCoV-WIV1 GenBank GenBank: AGZ48831 Civet-SARS-CoV-007/004 GenBank GenBank: AAU04646 Pangolin-CoV-GX-P2V GenBank GenBank: QIQ54048 SARS-CoV-1-Tor2 GenBank GenBank: AAP41037 SARS-CoV-1-Urbani GenBank GenBank: AAP13441 SARS-CoV-2 Wuhan-Hu-1 GenBank GenBank: YP_009724390 B.1.1.7 GenBank GenBank: QWE88920 B.1.351 GenBank GenBank: QRN78347 (Continued on next page) ll OPEN ACCESSArticle Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 e2 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010 .. P.1 GenBank GenBank: QVE55289 B.1.617.2 GenBank GenBank: QWK65230 BA.1 GenBank GenBank: UFO69279 BA.2 GenBank GenBank: UJE45220 BA.2.75 GenBank GenBank: UTM82166.1 BA.5 GenBank GenBank: UOZ45804.1 Bat-CoV-HKU4 UniProt UniProt: A3EX94 BatCoV-HKU5 GenBank GenBank: YP_001039962.1 MERS-EMC/2012 GenBank GenBank: YP_009047204 BatCoV-GCCDC1 GenBank GenBank: YP_009273005.1 BtRt-BetaCoV/GX2018 GenBank GenBank: QJX58383.1 BatCoV-HKU9 GenBank GenBank: ABN10911 Bat Hp-betacoronavirus/Zhejiang2013 GenBank GenBank: YP_009072440 SARS-CoV-2 GenBank GenBank: QHD43416.1 SARS-CoV GenBank GenBank: AAP13441.1 MERS-CoV GenBank GenBank: AFS88936 HCoV-NL63 GenBank GenBank: Q6Q1S2.1 MesAur1.0 genome assembly GenBank GenBank: GCA_00349664.1 Stem helix-specific mAbs GenBank GenBank: OP377774-OP377795 COV30-14 crystal structure PDB PDB: 8DTR COV89-22 crystal structure PDB PDB: 8DTX COV93-03 crystal structure PDB PDB: 8DTT Experimental models: cell lines Sf9 cells ATCC Cat. # CRL-1711; RRID: CVCL_0549 High Five cells ThermoFisher Scientific Cat. # B85502; RRID: CVCL_C190 FreeStyle 293-F cells ThermoFisher Scientific Cat. # R79007; RRID: CVCL_D603 Irradiated 3T3-CD40L cells Huang et al. (2013) N/A HeLa cells ATCC Cat. # CCL-2; RRID: CVCL_0030 Rhabdomyosarcoma cells ATCC Cat. # CCL136 VRC8400 cells Barouch et al. (2005) N/A HEK-293T cells ATCC Cat. # CRL-11268; RRID: CVCL_1926 293 flpin-TMPRSS2-ACE2 cells Dr. Adrian Creanga, VRC/NIH; Zhou et al. (2022c) N/A Huh7.5 cells Dr. Deborah Taylor, US FDA; Wang et al. (2015) N/A Expi293 cells Gibco Cat. # A14527; RRID: CVCL_D615 Vero E6 cells Expasy CVCL_XD71 Cat. # BEI NR-596; RRID: CVCL_XD71 HEK-Blue hACE2-TMPRSS2 cells Invivogen Cat. # hkb-hace2tpsa 293-hMyD88 cells Invivogen Cat. # 293-hmyd Oligonucleotides PCR primers for amplification of antibody heavy, kappa, and lambda genes Wang et al. (2020) GenBank: MT811859 – MT811914 PCR primers for generation of virus F1148, L1152 and F1156 mutants Table S3 (this study) N/A Experimental models: organisms Golden Syrian Hamsters Envigo (Indianapolis, IN USA) N/A Recombinant DNA pCMV-dR82 dvpr (AssayScripps) Addgene Cat. # 8455; RRID: Addgene_8455 pBOBI-FLuc (AssayScripps) Addgene Cat. # 170674; RRID: Addgene_170674 SARS-CoV (AssayScripps) Addgene Cat. # 170447; RRID: Addgene_170447 (Continued on next page) ll OPEN ACCESS Article e3 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010

    Virus:

    Article Title: Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses
    Article Snippet: Antibodies CD14-BV510 Biolegend Cat. # 301842; RRID: AB_2561946 CD3-BV510 Biolegend Cat. # 317332; RRID: AB_2561943 CD56-BV510 Biolegend Cat. # 318340; RRID: AB_2561944 CD19-ECD Beckman Coulter Cat. # IM2708U; RRID: AB_130854 CD21-BV711 BD Cat. # 563163; RRID: AB_2738040 IgA-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-011; RRID: AB_2337895 IgD-PE-Cy7 BD Cat. # 561314; RRID: AB_10642457 IgM-PerCP-Cy5.5 BD Cat. # 561285; RRID: AB_10611998 CD27-Alexa Fluor 488 Biolegend Cat. # 393204; RRID: AB_2750089 CD38-APC-Cy7 Biolegend Cat. # 303534; RRID: AB_2561605 goat anti-human IgG-Alexa Fluor 647 Jackson Immunoresearch Cat. # 109-606-170; RRID: AB_2337902 goat anti-human IgA-Cy3 Jackson Immunoresearch Cat. # 109-166-011; RRID: AB_2337733 Alexa-Fluor-488-conjugated anti-IgG Jackson Immunoresearch Cat. # 109-545-003; RRID: AB_2337831 CC6.29 Rogers et al. (2020) N/A CC6.33 Rogers et al. (2020) N/A L25-dP06E11 Rogers et al. (2020) N/A CC12.23 Rogers et al. (2020) N/A CC12.25 Rogers et al. (2020) N/A anti-MERS-CoV spike primary antibody Sino Biological Cat. # 40069-R723; RRID: AB_2860455 goat anti-rabbit antibody Alexa Fluor 647 Life Technologies Cat. # A21245; RRID: AB_2535813 Anti-His biotin Invitrogen Cat. # MA1-21315-BTIN; RRID: AB_2536983 L9 Wang et al. (2020) N/A Virus strains SARS-CoV-2 Centers for Disease Control and Prevention (CDC) GenBank: MT952134 MERS-CoV Armed Forces Health Surveillance Center GenBank: KC776174 GFP-expressing HCoV-OC43 virus Yewdell lab, NIAID N/A Biological samples COVID-19 convalescent human blood and plasma samples New York Blood Center N/A Plasma/serum samples from mRNA1273 vaccine (Moderna) recipients NIH Clinical Research Center N/A Chemicals, peptides and recombinant proteins HCoV-NL63 spike Sino Biological Cat. # 40604-V08B-B HCoV-229E spike Sino Biological Cat. # 40605-V08B-B HCoV-HKU1 spike Sino Biological Cat. # 40606-V08B HCoV-OC43 spike Bangaru et al. (2022) N/A MERS-CoV spike Bangaru et al. (2022) N/A NL63-CoV spike Sino Biological Cat. # 40604-V08B-B 229E-CoV spike Sino Biological Cat. # 40605-V08B-B HKU1-CoV spike Sino Biological Cat. # 40606-V08B SARS-CoV-2 S2 subunit R&D Systems Cat. # 10594-CV-100 Protein G Elution Buffer Thermo Scientific Cat. # 21004 IL21 Gibco Cat. # PHC0211 (Continued on next page) e1 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 .. R848 Invivogen Cat. # tlrl-r848 Mycozap Lonza Cat. # VZA-2021 Gentamicin Quality Biological Cat. # 120-098-661 GlutaMax Gibco Cat. # 11965-092 Normocin Invivogen Cat. # ant-nr-1 Puromycin Invivogen Cat. # ant-pr-1 Hygromycin B Gold Invivogen Cat. # ant-hg-1 Zeocin Invivogen Cat. # ant-zn-05 Penicillin/Streptomycin Invitrogen Cat. # 15140122 A/Solomon Islands/03/2006 (H1N1) hemagglutinin ectodomain Ekiert et al. (2012) N/A CD4 Crosnier et al. (2013) N/A 2.5 mm streptavidin beads, Yellow, Odd # peaks Spherotech Cat. # SVFA-2552-6K 2.5 mm streptavidin beads, Yellow, Even # peaks Spherotech Cat. # SVFB-2552-6K 2.5 mm streptavidin beads, Pink, Odd # peaks Spherotech Cat. # SVFA-2558-6K 2.5 mm streptavidin beads, Pink, Even # peaks Spherotech Cat. # SVFB-2558-6K 7 mm streptavidin beads Spherotech Cat. # SVP-60-5 Lipofectamine 2000 ThermoFisher Scientific Cat. # 11668019 Lipofectamine 3000 transfection reagent ThermoFisher Scientific Cat. # L3000-001 Lyophilized 15-mer peptides JPT Peptide Technologies N/A Horseradish peroxidase Invitrogen Cat. # A18817 POD substrate Roche Cat. # 11582950001 Dynabeads mRNA DIRECT lysis buffer Life Technologies Cat. # 61011 HyClone insect cell culture medium GE Healthcare Cat. # SH30280.03 PEIMax Polysciences Cat. # 24765-1 QUANTI-Blue Solution Invivogen Cat. # rep-qbs Critical commercial assays Bac-to-Bac system Life Technologies Cat. # 10359016 Bright-Glo Luciferase Assay System Promega Cat. # E2620 ScisGo -HLA-v6 kit Scisco Genetics Inc. Cat. # HLA-24S-v6 Pierce Fab Preparation kit ThermoFisher Scientific Cat. # 44985 ExpiCHO expression system ThermoFisher Scientific Cat. # A29133 Expi293F expression system ThermoFisher Scientific Cat. # A14635 ExpiFectamine 293 Transfection Kit ThermoFisher Scientific Cat. # A14524 Deposited data Mouse Hepatitis Virus UniProt UniProt: P11224 HCoV-OC43 UniProt UniProt: P36334 HCoV-HKU1 N5 UniProt UniProt: Q0ZME7 BatCoV-HKU3 UniProt UniProt: Q3LZX1 BatCoV-RaTG13 GenBank GenBank: QHR63300 BatCoV-Rs4231 GenBank GenBank: ATO98157 BatCoV-Rs3367 GenBank GenBank: AGZ48818 BatCoV-WIV1 GenBank GenBank: AGZ48831 Civet-SARS-CoV-007/004 GenBank GenBank: AAU04646 Pangolin-CoV-GX-P2V GenBank GenBank: QIQ54048 SARS-CoV-1-Tor2 GenBank GenBank: AAP41037 SARS-CoV-1-Urbani GenBank GenBank: AAP13441 SARS-CoV-2 Wuhan-Hu-1 GenBank GenBank: YP_009724390 B.1.1.7 GenBank GenBank: QWE88920 B.1.351 GenBank GenBank: QRN78347 (Continued on next page) ll OPEN ACCESSArticle Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 e2 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010 .. P.1 GenBank GenBank: QVE55289 B.1.617.2 GenBank GenBank: QWK65230 BA.1 GenBank GenBank: UFO69279 BA.2 GenBank GenBank: UJE45220 BA.2.75 GenBank GenBank: UTM82166.1 BA.5 GenBank GenBank: UOZ45804.1 Bat-CoV-HKU4 UniProt UniProt: A3EX94 BatCoV-HKU5 GenBank GenBank: YP_001039962.1 MERS-EMC/2012 GenBank GenBank: YP_009047204 BatCoV-GCCDC1 GenBank GenBank: YP_009273005.1 BtRt-BetaCoV/GX2018 GenBank GenBank: QJX58383.1 BatCoV-HKU9 GenBank GenBank: ABN10911 Bat Hp-betacoronavirus/Zhejiang2013 GenBank GenBank: YP_009072440 SARS-CoV-2 GenBank GenBank: QHD43416.1 SARS-CoV GenBank GenBank: AAP13441.1 MERS-CoV GenBank GenBank: AFS88936 HCoV-NL63 GenBank GenBank: Q6Q1S2.1 MesAur1.0 genome assembly GenBank GenBank: GCA_00349664.1 Stem helix-specific mAbs GenBank GenBank: OP377774-OP377795 COV30-14 crystal structure PDB PDB: 8DTR COV89-22 crystal structure PDB PDB: 8DTX COV93-03 crystal structure PDB PDB: 8DTT Experimental models: cell lines Sf9 cells ATCC Cat. # CRL-1711; RRID: CVCL_0549 High Five cells ThermoFisher Scientific Cat. # B85502; RRID: CVCL_C190 FreeStyle 293-F cells ThermoFisher Scientific Cat. # R79007; RRID: CVCL_D603 Irradiated 3T3-CD40L cells Huang et al. (2013) N/A HeLa cells ATCC Cat. # CCL-2; RRID: CVCL_0030 Rhabdomyosarcoma cells ATCC Cat. # CCL136 VRC8400 cells Barouch et al. (2005) N/A HEK-293T cells ATCC Cat. # CRL-11268; RRID: CVCL_1926 293 flpin-TMPRSS2-ACE2 cells Dr. Adrian Creanga, VRC/NIH; Zhou et al. (2022c) N/A Huh7.5 cells Dr. Deborah Taylor, US FDA; Wang et al. (2015) N/A Expi293 cells Gibco Cat. # A14527; RRID: CVCL_D615 Vero E6 cells Expasy CVCL_XD71 Cat. # BEI NR-596; RRID: CVCL_XD71 HEK-Blue hACE2-TMPRSS2 cells Invivogen Cat. # hkb-hace2tpsa 293-hMyD88 cells Invivogen Cat. # 293-hmyd Oligonucleotides PCR primers for amplification of antibody heavy, kappa, and lambda genes Wang et al. (2020) GenBank: MT811859 – MT811914 PCR primers for generation of virus F1148, L1152 and F1156 mutants Table S3 (this study) N/A Experimental models: organisms Golden Syrian Hamsters Envigo (Indianapolis, IN USA) N/A Recombinant DNA pCMV-dR82 dvpr (AssayScripps) Addgene Cat. # 8455; RRID: Addgene_8455 pBOBI-FLuc (AssayScripps) Addgene Cat. # 170674; RRID: Addgene_170674 SARS-CoV (AssayScripps) Addgene Cat. # 170447; RRID: Addgene_170447 (Continued on next page) ll OPEN ACCESS Article e3 Cell Host & Microbe 31, 1–15.e1–e12, January 11, 2023 Please cite this article in press as: Dacon et al., Rare, convergent antibodies targeting the stem helix broadly neutralize diverse betacoronaviruses, Cell Host & Microbe (2022), https://doi.org/10.1016/j.chom.2022.10.010

    Plasmid Preparation:

    Article Title: Targeting EP2/EP4-driven expansion of suppressive VSIG4 high macrophages overcomes immunotherapy resistance in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: mCreb1 pcDNA3.1-3xFlag-C This study N/A Plasmid: pcDNA5-mVsig4 This study N/A Software and algorithms FlowJo V10.0 software FlowJo https://www.flowjo.com/ GraphPad Prism V9.2.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ InDraw V7.0 Integle https://www.integle.com/static/indraw AutoDockTools v.1.5.7 Eberhardt, Jerome et al., 2021 https://ccsb.scripps.edu/ The PyMOL Molecular Graphics System Schrödinger, LLC https://pymol.org/ GSEA 4.1.0 (Mootha et al., 2003; Subramanian et al., 2005) http://www.gsea-msigdb.org/gsea/ R 4.3.3 The R Foundation for Statistical Computing https://www.r-project.org/ Rstudio Server RStudio, PBC https://www.rstudio.com/tags/rstudio-ide/ Adobe Illustrator 2021 Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html Other DMEM Gibco Cat#11965092 RPMI-1640 Gibco Cat#11875093 DMEM/F12 Gibco Cat#11320033 FBS Gibco Cat#A5256701 Penicillin/streptomycin Gibco Cat#15140122 Normocin InvivoGen Catant-nr-05 Pen-Strep Glutamine Gibco Cat#10378016 Ham’s F-12 culture medium Gibco Cat#21765037 Millicell® 6 well standing inserts Millipore Cat#PICM03050 Collagen I Gibco Cat#A1048301 Advanced DMEM/F12 Gibco Cat#12634010 B-27 without vitamin A Gibco Cat#12587001 GlutaMAX Gibco Cat#35050061 HEPES Gibco Cat#15630130 Paraformaldehyde Sigma Aldrich Cat#441244 Clodronate Liposomes Yeasen Cat#40337ES10 Control Liposomes (PBS) Yeasen Cat#40338ES10 Collagenase I Gibco Cat#17100017 Collagenase IV Gibco Cat#17104019 Proteose peptone Sigma Aldrich Cat#82450 Protein A + G Agarose (Fast Flow) Beyotime Cat#P2012 RBC lysis buffer Invitrogen Cat#00-4300-54 24 Cell Reports 45, 117450, June 23, 2026 .. Mice peritoneal macrophages were isolated as described previously.68 Briefly, WT, Ptger2− /− , Ptger4fl/fl, and Ptger4fl/fl LysM-Cre 6-8-week-old male or female C57BL/6J mice were subjected to daily intraperitoneal injections of 3% proteose peptone broth (Sigma Aldrich) at a dosage of 1 mL per day for three consecutive days.

    Software:

    Article Title: Targeting EP2/EP4-driven expansion of suppressive VSIG4 high macrophages overcomes immunotherapy resistance in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: mCreb1 pcDNA3.1-3xFlag-C This study N/A Plasmid: pcDNA5-mVsig4 This study N/A Software and algorithms FlowJo V10.0 software FlowJo https://www.flowjo.com/ GraphPad Prism V9.2.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ InDraw V7.0 Integle https://www.integle.com/static/indraw AutoDockTools v.1.5.7 Eberhardt, Jerome et al., 2021 https://ccsb.scripps.edu/ The PyMOL Molecular Graphics System Schrödinger, LLC https://pymol.org/ GSEA 4.1.0 (Mootha et al., 2003; Subramanian et al., 2005) http://www.gsea-msigdb.org/gsea/ R 4.3.3 The R Foundation for Statistical Computing https://www.r-project.org/ Rstudio Server RStudio, PBC https://www.rstudio.com/tags/rstudio-ide/ Adobe Illustrator 2021 Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html Other DMEM Gibco Cat#11965092 RPMI-1640 Gibco Cat#11875093 DMEM/F12 Gibco Cat#11320033 FBS Gibco Cat#A5256701 Penicillin/streptomycin Gibco Cat#15140122 Normocin InvivoGen Catant-nr-05 Pen-Strep Glutamine Gibco Cat#10378016 Ham’s F-12 culture medium Gibco Cat#21765037 Millicell® 6 well standing inserts Millipore Cat#PICM03050 Collagen I Gibco Cat#A1048301 Advanced DMEM/F12 Gibco Cat#12634010 B-27 without vitamin A Gibco Cat#12587001 GlutaMAX Gibco Cat#35050061 HEPES Gibco Cat#15630130 Paraformaldehyde Sigma Aldrich Cat#441244 Clodronate Liposomes Yeasen Cat#40337ES10 Control Liposomes (PBS) Yeasen Cat#40338ES10 Collagenase I Gibco Cat#17100017 Collagenase IV Gibco Cat#17104019 Proteose peptone Sigma Aldrich Cat#82450 Protein A + G Agarose (Fast Flow) Beyotime Cat#P2012 RBC lysis buffer Invitrogen Cat#00-4300-54 24 Cell Reports 45, 117450, June 23, 2026 .. Mice peritoneal macrophages were isolated as described previously.68 Briefly, WT, Ptger2− /− , Ptger4fl/fl, and Ptger4fl/fl LysM-Cre 6-8-week-old male or female C57BL/6J mice were subjected to daily intraperitoneal injections of 3% proteose peptone broth (Sigma Aldrich) at a dosage of 1 mL per day for three consecutive days.

    Liposomes:

    Article Title: Targeting EP2/EP4-driven expansion of suppressive VSIG4 high macrophages overcomes immunotherapy resistance in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: mCreb1 pcDNA3.1-3xFlag-C This study N/A Plasmid: pcDNA5-mVsig4 This study N/A Software and algorithms FlowJo V10.0 software FlowJo https://www.flowjo.com/ GraphPad Prism V9.2.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ InDraw V7.0 Integle https://www.integle.com/static/indraw AutoDockTools v.1.5.7 Eberhardt, Jerome et al., 2021 https://ccsb.scripps.edu/ The PyMOL Molecular Graphics System Schrödinger, LLC https://pymol.org/ GSEA 4.1.0 (Mootha et al., 2003; Subramanian et al., 2005) http://www.gsea-msigdb.org/gsea/ R 4.3.3 The R Foundation for Statistical Computing https://www.r-project.org/ Rstudio Server RStudio, PBC https://www.rstudio.com/tags/rstudio-ide/ Adobe Illustrator 2021 Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html Other DMEM Gibco Cat#11965092 RPMI-1640 Gibco Cat#11875093 DMEM/F12 Gibco Cat#11320033 FBS Gibco Cat#A5256701 Penicillin/streptomycin Gibco Cat#15140122 Normocin InvivoGen Catant-nr-05 Pen-Strep Glutamine Gibco Cat#10378016 Ham’s F-12 culture medium Gibco Cat#21765037 Millicell® 6 well standing inserts Millipore Cat#PICM03050 Collagen I Gibco Cat#A1048301 Advanced DMEM/F12 Gibco Cat#12634010 B-27 without vitamin A Gibco Cat#12587001 GlutaMAX Gibco Cat#35050061 HEPES Gibco Cat#15630130 Paraformaldehyde Sigma Aldrich Cat#441244 Clodronate Liposomes Yeasen Cat#40337ES10 Control Liposomes (PBS) Yeasen Cat#40338ES10 Collagenase I Gibco Cat#17100017 Collagenase IV Gibco Cat#17104019 Proteose peptone Sigma Aldrich Cat#82450 Protein A + G Agarose (Fast Flow) Beyotime Cat#P2012 RBC lysis buffer Invitrogen Cat#00-4300-54 24 Cell Reports 45, 117450, June 23, 2026 .. Mice peritoneal macrophages were isolated as described previously.68 Briefly, WT, Ptger2− /− , Ptger4fl/fl, and Ptger4fl/fl LysM-Cre 6-8-week-old male or female C57BL/6J mice were subjected to daily intraperitoneal injections of 3% proteose peptone broth (Sigma Aldrich) at a dosage of 1 mL per day for three consecutive days.

    Control:

    Article Title: Targeting EP2/EP4-driven expansion of suppressive VSIG4 high macrophages overcomes immunotherapy resistance in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: mCreb1 pcDNA3.1-3xFlag-C This study N/A Plasmid: pcDNA5-mVsig4 This study N/A Software and algorithms FlowJo V10.0 software FlowJo https://www.flowjo.com/ GraphPad Prism V9.2.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ InDraw V7.0 Integle https://www.integle.com/static/indraw AutoDockTools v.1.5.7 Eberhardt, Jerome et al., 2021 https://ccsb.scripps.edu/ The PyMOL Molecular Graphics System Schrödinger, LLC https://pymol.org/ GSEA 4.1.0 (Mootha et al., 2003; Subramanian et al., 2005) http://www.gsea-msigdb.org/gsea/ R 4.3.3 The R Foundation for Statistical Computing https://www.r-project.org/ Rstudio Server RStudio, PBC https://www.rstudio.com/tags/rstudio-ide/ Adobe Illustrator 2021 Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html Other DMEM Gibco Cat#11965092 RPMI-1640 Gibco Cat#11875093 DMEM/F12 Gibco Cat#11320033 FBS Gibco Cat#A5256701 Penicillin/streptomycin Gibco Cat#15140122 Normocin InvivoGen Catant-nr-05 Pen-Strep Glutamine Gibco Cat#10378016 Ham’s F-12 culture medium Gibco Cat#21765037 Millicell® 6 well standing inserts Millipore Cat#PICM03050 Collagen I Gibco Cat#A1048301 Advanced DMEM/F12 Gibco Cat#12634010 B-27 without vitamin A Gibco Cat#12587001 GlutaMAX Gibco Cat#35050061 HEPES Gibco Cat#15630130 Paraformaldehyde Sigma Aldrich Cat#441244 Clodronate Liposomes Yeasen Cat#40337ES10 Control Liposomes (PBS) Yeasen Cat#40338ES10 Collagenase I Gibco Cat#17100017 Collagenase IV Gibco Cat#17104019 Proteose peptone Sigma Aldrich Cat#82450 Protein A + G Agarose (Fast Flow) Beyotime Cat#P2012 RBC lysis buffer Invitrogen Cat#00-4300-54 24 Cell Reports 45, 117450, June 23, 2026 .. Mice peritoneal macrophages were isolated as described previously.68 Briefly, WT, Ptger2− /− , Ptger4fl/fl, and Ptger4fl/fl LysM-Cre 6-8-week-old male or female C57BL/6J mice were subjected to daily intraperitoneal injections of 3% proteose peptone broth (Sigma Aldrich) at a dosage of 1 mL per day for three consecutive days.

    Red Blood Cell Lysis:

    Article Title: Targeting EP2/EP4-driven expansion of suppressive VSIG4 high macrophages overcomes immunotherapy resistance in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: mCreb1 pcDNA3.1-3xFlag-C This study N/A Plasmid: pcDNA5-mVsig4 This study N/A Software and algorithms FlowJo V10.0 software FlowJo https://www.flowjo.com/ GraphPad Prism V9.2.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ InDraw V7.0 Integle https://www.integle.com/static/indraw AutoDockTools v.1.5.7 Eberhardt, Jerome et al., 2021 https://ccsb.scripps.edu/ The PyMOL Molecular Graphics System Schrödinger, LLC https://pymol.org/ GSEA 4.1.0 (Mootha et al., 2003; Subramanian et al., 2005) http://www.gsea-msigdb.org/gsea/ R 4.3.3 The R Foundation for Statistical Computing https://www.r-project.org/ Rstudio Server RStudio, PBC https://www.rstudio.com/tags/rstudio-ide/ Adobe Illustrator 2021 Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html Other DMEM Gibco Cat#11965092 RPMI-1640 Gibco Cat#11875093 DMEM/F12 Gibco Cat#11320033 FBS Gibco Cat#A5256701 Penicillin/streptomycin Gibco Cat#15140122 Normocin InvivoGen Catant-nr-05 Pen-Strep Glutamine Gibco Cat#10378016 Ham’s F-12 culture medium Gibco Cat#21765037 Millicell® 6 well standing inserts Millipore Cat#PICM03050 Collagen I Gibco Cat#A1048301 Advanced DMEM/F12 Gibco Cat#12634010 B-27 without vitamin A Gibco Cat#12587001 GlutaMAX Gibco Cat#35050061 HEPES Gibco Cat#15630130 Paraformaldehyde Sigma Aldrich Cat#441244 Clodronate Liposomes Yeasen Cat#40337ES10 Control Liposomes (PBS) Yeasen Cat#40338ES10 Collagenase I Gibco Cat#17100017 Collagenase IV Gibco Cat#17104019 Proteose peptone Sigma Aldrich Cat#82450 Protein A + G Agarose (Fast Flow) Beyotime Cat#P2012 RBC lysis buffer Invitrogen Cat#00-4300-54 24 Cell Reports 45, 117450, June 23, 2026 .. Mice peritoneal macrophages were isolated as described previously.68 Briefly, WT, Ptger2− /− , Ptger4fl/fl, and Ptger4fl/fl LysM-Cre 6-8-week-old male or female C57BL/6J mice were subjected to daily intraperitoneal injections of 3% proteose peptone broth (Sigma Aldrich) at a dosage of 1 mL per day for three consecutive days.

    Staining:

    Article Title: Longitudinal analysis of the gut microbiota during anti-PD-1 therapy reveals stable microbial features of response in melanoma patients.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MEL-A Dako M7196 PRAME Abcam Cat#Ab219650; RRID:AB_219650 CCR7 BV421 BD Biosciences Cat#150503 CD8 BV605 BD Biosciences Cat#564116; RRID:AB_2869551 CD25 BV786 BD Biosciences Cat#741035; RRID:AB_2740625 CD45RA PE BD Biosciences Cat#561883; RRID:AB_10895572 CD69 APC BD Biosciences Cat#555533; RRID: AB_398602 CD3 APCR700 BD Biosciences Cat#565119; RRID:AB_2744385 CXCR3 PerCP-Cy5.5 BD Biosciences Cat#560832; RRID:AB_2033945 IL17A FITC Invitrogen Cat#11-7179-42 IFNG PE-CF594 BD Biosciences Cat#562392; RRID:AB_11153859 TNFA APC-CY7 BioLegend Cat#502944; RRID:AB_2562870 HLADR BV605 BD Biosciences Cat#562845 TLR5 APCR700 Bio-techne R&D Systems Cat#FAB6704N; RRID:AB_3651878 Biological Samples Fecal and Blood Samples from Patients with Melanoma Istituto Europeo di Oncologia; Istituto Nazionale Tumori IRCCS Fondazione G. Pascale R845/18-IEO 889; 37/22 oss Chemicals, Peptides, and Recombinant Proteins Stool Sample Collection & Stabilization Kit Canvax Cat#SC0012 Bovine Serum Albumin Seqens Cas#1005-70 Goat Serum Invitrogen Cat#10000 C HRP-Secondary Antibody (Anti-Rabbit) Agilent Dako Cat#K4003; RRID:AB_2630375 Aminoethyl Carbazole (AEC) + High Sensitivity Substrate Chromogen Agilent Dako Cat#K3461 Hematoxylin Sigma Cat#MHS 16–500ML RPMI-1640 Euroclone Cat#ECM2001L DMEM Euroclone Cat#ECM0103L FBS Euroclone Cat#ECS0165L Hepes Sigma Cat#H0087 Sodium Pyruvate Euroclone Cat#ECM0742D Pen/Strep Euroclone Cat#ECB3001D Glutamine Euroclone Cat#LOBE17605E Normocin InvivoGen Cat#ant-nr Recombinant Human IL-2 Novartis Cat#CLB-P-476-800-13980 IT Anti-CD28/49d BD Biosciences Cat#347690; RRID:AB_647457 Golgi Plug BD Biosciences Cat#555029 Fixation/Permeabilization Solution Kit BD Biosciences Cat#554714 Cytofix/Cytoperm BD Biosciences Cat#554722 Fixable Viability Stain BV510 BD Biosciences Cat#564406 Purified Custom Peptides GenScript (See Table S7) NA UltraPure Flagellin from Salmonella typhimurium InvivoGen Cat#TLR-STFLA Critical Commercial Assays DNeasy PowerSoil Pro Kit Qiagen Cat#47016 MiSeq Reagent Kit V2 Illumina Cat#MS-102-2003 (Continued on next page) Cell Host & Microbe 32, 2004–2018.e1–e9, November 13, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Nextera XT Index Kit V2 Set A Illumina Cat#FC-131-2001 Qubit dsDNA HS Assay Kit Thermofisher Cat#Q32851 Kapa HiFi HotStart ReadyMix Fisher Scientific Cat#50-196-5299 Human Magnetic Luminex Screening Assay Bio-techne Cat#LXSAHM-23 Deposited Data Raw 16S and/or Shotgun data This paper; Baruch et al.9; Davar et al.10; Routy et al.5; Bjork et al.14 PRJEB61942; PRJNA678737; PRJNA672867; PRJNA928744; PRJEB70966, PRJEB43119 Analyzed Shotgun data Lee et al.8; Bjork et al.14 https://bioconductor.org/packages/ curatedMetagenomicData/ Source code/scripts to analyse the data This paper; Biobakery63 https://github.com/ADGM/ melanoma-longitudinal-paper https://github.com/SegataLab/ preprocessing SILVA 128 database; SILVA 132 database Quast et al.64 https://www.arb-silva.de/fileadmin/ silva_databases/qiime/Silva_128_ release.tgz; https://www.arb-silva.de/ fileadmin/silva_databases/qiime/ Silva_132_release.zip CHOCOPhlAnSGB v202103 database Blanco-Mı́guez et al.65 =https://github.com/biobakery/ humann?tab=readme-ovfile#download-the-chocophlandatabase UniRef90 database Suzek et al.66 https://www.uniprot.org/ Pathway–KO mapping file PICRUSt2 https://github.com/picrust/picrust2/ blob/master/picrust2/default_files/ pathway_mapfiles/KEGG_pathways_ to_KO.tsv KO–pathway mapping file Beghini et al.63 https://github.com/biobakery/humann/ blob/master/humann/data/misc/ map_kegg-pwy_name.txt.gz Experimental models: Cell lines HEK-Blue hTLR5 Invivogen Cat#hkb-htlr5; RRID:CVCL_IM83 Oligonucleotides 16S Amplicon PCR Forward Primer TCGTCGGCAGCGTCAGATGTGTATA AGAGACAGCCTACGGGNGGCWGCAG Illumina NA 16S Amplicon PCR Reverse Primer GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGGACTACHVGGGTATCTAATCC Illumina NA Software and algorithms R version v4.1.1 (2021-08-10) R Core Team67 https://www.r-project.org RStudio v2022.07.2+576 RStudio https://posit.co Inkscape v1.2.2 Inkscape Developers https://inkscape.org/ BioRender BioRender https://www.biorender.com/ qiime2-2018.11; qiime2-2019.7 Bolyen et al.68 https://qiime2.org/ qiime2-2018.11 DADA2 plug-in Callahan et al.69 https://docs.qiime2.org/2018.11/plugins/ available/dada2/index.html qiime2-2019.7 SEPP fragment insertion plug-in; qiime2-2019.7 naive Bayes feature classifier plug-in Janssen et al.70; Bokulich et al.71 https://docs.qiime2.org/2019.7/plugins/ available/fragment-insertion/sepp/; https://docs.qiime2.org/2019.7/plugins/ available/feature-classifier/fitclassifier-naive-bayes/ (Continued on next page) e2 Cell Host & Microbe 32, 2004–2018.e1–e9, November 13, 2024

    Purification:

    Article Title: Longitudinal analysis of the gut microbiota during anti-PD-1 therapy reveals stable microbial features of response in melanoma patients.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MEL-A Dako M7196 PRAME Abcam Cat#Ab219650; RRID:AB_219650 CCR7 BV421 BD Biosciences Cat#150503 CD8 BV605 BD Biosciences Cat#564116; RRID:AB_2869551 CD25 BV786 BD Biosciences Cat#741035; RRID:AB_2740625 CD45RA PE BD Biosciences Cat#561883; RRID:AB_10895572 CD69 APC BD Biosciences Cat#555533; RRID: AB_398602 CD3 APCR700 BD Biosciences Cat#565119; RRID:AB_2744385 CXCR3 PerCP-Cy5.5 BD Biosciences Cat#560832; RRID:AB_2033945 IL17A FITC Invitrogen Cat#11-7179-42 IFNG PE-CF594 BD Biosciences Cat#562392; RRID:AB_11153859 TNFA APC-CY7 BioLegend Cat#502944; RRID:AB_2562870 HLADR BV605 BD Biosciences Cat#562845 TLR5 APCR700 Bio-techne R&D Systems Cat#FAB6704N; RRID:AB_3651878 Biological Samples Fecal and Blood Samples from Patients with Melanoma Istituto Europeo di Oncologia; Istituto Nazionale Tumori IRCCS Fondazione G. Pascale R845/18-IEO 889; 37/22 oss Chemicals, Peptides, and Recombinant Proteins Stool Sample Collection & Stabilization Kit Canvax Cat#SC0012 Bovine Serum Albumin Seqens Cas#1005-70 Goat Serum Invitrogen Cat#10000 C HRP-Secondary Antibody (Anti-Rabbit) Agilent Dako Cat#K4003; RRID:AB_2630375 Aminoethyl Carbazole (AEC) + High Sensitivity Substrate Chromogen Agilent Dako Cat#K3461 Hematoxylin Sigma Cat#MHS 16–500ML RPMI-1640 Euroclone Cat#ECM2001L DMEM Euroclone Cat#ECM0103L FBS Euroclone Cat#ECS0165L Hepes Sigma Cat#H0087 Sodium Pyruvate Euroclone Cat#ECM0742D Pen/Strep Euroclone Cat#ECB3001D Glutamine Euroclone Cat#LOBE17605E Normocin InvivoGen Cat#ant-nr Recombinant Human IL-2 Novartis Cat#CLB-P-476-800-13980 IT Anti-CD28/49d BD Biosciences Cat#347690; RRID:AB_647457 Golgi Plug BD Biosciences Cat#555029 Fixation/Permeabilization Solution Kit BD Biosciences Cat#554714 Cytofix/Cytoperm BD Biosciences Cat#554722 Fixable Viability Stain BV510 BD Biosciences Cat#564406 Purified Custom Peptides GenScript (See Table S7) NA UltraPure Flagellin from Salmonella typhimurium InvivoGen Cat#TLR-STFLA Critical Commercial Assays DNeasy PowerSoil Pro Kit Qiagen Cat#47016 MiSeq Reagent Kit V2 Illumina Cat#MS-102-2003 (Continued on next page) Cell Host & Microbe 32, 2004–2018.e1–e9, November 13, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Nextera XT Index Kit V2 Set A Illumina Cat#FC-131-2001 Qubit dsDNA HS Assay Kit Thermofisher Cat#Q32851 Kapa HiFi HotStart ReadyMix Fisher Scientific Cat#50-196-5299 Human Magnetic Luminex Screening Assay Bio-techne Cat#LXSAHM-23 Deposited Data Raw 16S and/or Shotgun data This paper; Baruch et al.9; Davar et al.10; Routy et al.5; Bjork et al.14 PRJEB61942; PRJNA678737; PRJNA672867; PRJNA928744; PRJEB70966, PRJEB43119 Analyzed Shotgun data Lee et al.8; Bjork et al.14 https://bioconductor.org/packages/ curatedMetagenomicData/ Source code/scripts to analyse the data This paper; Biobakery63 https://github.com/ADGM/ melanoma-longitudinal-paper https://github.com/SegataLab/ preprocessing SILVA 128 database; SILVA 132 database Quast et al.64 https://www.arb-silva.de/fileadmin/ silva_databases/qiime/Silva_128_ release.tgz; https://www.arb-silva.de/ fileadmin/silva_databases/qiime/ Silva_132_release.zip CHOCOPhlAnSGB v202103 database Blanco-Mı́guez et al.65 =https://github.com/biobakery/ humann?tab=readme-ovfile#download-the-chocophlandatabase UniRef90 database Suzek et al.66 https://www.uniprot.org/ Pathway–KO mapping file PICRUSt2 https://github.com/picrust/picrust2/ blob/master/picrust2/default_files/ pathway_mapfiles/KEGG_pathways_ to_KO.tsv KO–pathway mapping file Beghini et al.63 https://github.com/biobakery/humann/ blob/master/humann/data/misc/ map_kegg-pwy_name.txt.gz Experimental models: Cell lines HEK-Blue hTLR5 Invivogen Cat#hkb-htlr5; RRID:CVCL_IM83 Oligonucleotides 16S Amplicon PCR Forward Primer TCGTCGGCAGCGTCAGATGTGTATA AGAGACAGCCTACGGGNGGCWGCAG Illumina NA 16S Amplicon PCR Reverse Primer GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGGACTACHVGGGTATCTAATCC Illumina NA Software and algorithms R version v4.1.1 (2021-08-10) R Core Team67 https://www.r-project.org RStudio v2022.07.2+576 RStudio https://posit.co Inkscape v1.2.2 Inkscape Developers https://inkscape.org/ BioRender BioRender https://www.biorender.com/ qiime2-2018.11; qiime2-2019.7 Bolyen et al.68 https://qiime2.org/ qiime2-2018.11 DADA2 plug-in Callahan et al.69 https://docs.qiime2.org/2018.11/plugins/ available/dada2/index.html qiime2-2019.7 SEPP fragment insertion plug-in; qiime2-2019.7 naive Bayes feature classifier plug-in Janssen et al.70; Bokulich et al.71 https://docs.qiime2.org/2019.7/plugins/ available/fragment-insertion/sepp/; https://docs.qiime2.org/2019.7/plugins/ available/feature-classifier/fitclassifier-naive-bayes/ (Continued on next page) e2 Cell Host & Microbe 32, 2004–2018.e1–e9, November 13, 2024

    Polymerase Chain Reaction:

    Article Title: Unified framework for patient-derived, tumor-organoid-based predictive testing of standard-of-care therapies in metastatic colorectal cancer
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Ki67 antibody DAKO Cat#M7240, RRID: AB_2142367 Mouse anti-MUC2 antibody Santa Cruz Biotechnology Cat#sc-7314, RRID: AB_627970 Mouse anti-p53 antibody Santa Cruz Biotechnology Cat#sc-126, RRID: AB_628082 Biological samples Human colorectal cancer tissues This paper N/A Human normal colon tissues This paper N/A Buffy coat from patient blood samples This paper N/A Chemicals, peptides, and recombinant proteins GlutaMax supplement Gibco Cat#35050061 HEPES Sigma-Aldrich Cat#H3375-1KG B-27 supplement Life Technologies Cat#17504001 N2 supplement Life Technologies Cat#17502001 Nicotinamide Sigma-Aldrich Cat#72340-1KG N-acetyl-L-cysteine Sigma-Aldrich Cat#A7250-1KG Recombinant human basic FGF Life Technologies Cat#PHG0263 Recombinant human EGF Life Technologies Cat#PHG0313 A83-01 Tocris Bioscience Cat#2939 Primocin Invivogen Cat#ant-pm-2 Y27632 Stemcell Technologies Cat#72308 Matrigel Corning Cat#356234 Penicillin-streptomycin Life Technologies Cat#15140122 Normocin Invivogen Catant-nr-2 Dispase II Life Technologies Cat#17105-041 Collagenase IV Life Technologies Cat#17104019 TrypLE Express enzyme Thermo Fisher Scientific Cat#12604021 Tissue-Tek O.C.T Compound Emgrid Cat#4583 HistoGel Themo Fisher Scientific Cat#22-110-678 Critical commercial assays ISOLATE II Genomic DNA Kit Bioline Cat#BIO-52067 DIPSEQ platform (BGI) BGI N/A MGIEasy Universal DNA Library Prep Set MGI Cat#1000006986 LookOut Mycoplasma PCR Detection Kit Sigma-Aldrich MP0035-1KT Dako Omnis platform Agilent N/A Deposited data Whole genome sequencing data This paper; The CNGB Sequence Archive (CNSA) of China National GeneBank DataBase (CNGBdb) Accession numbers of whole-genome sequencing data in CNGBdb: CNP0001424 and CNP0003751 (https://db.cngb.org/cnsa/) hg38 GCA_000001405.15_GRCh38_no_ alt_analysis_set.fna downloaded from HMFTools-Resources https://nextcloud.hartwigmedicalfoundation. nl/s/LTiKTd8XxBqwaiC?path = %2 FHMFTools-Resources Experimental models: Organisms/strains Patient-derived colorectal cancer organoids This paper N/A (Continued on next page) e1 Cell Reports Medicine 4, 101335, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms SOAPnuke (v2.1.7) Chen et al.48 https://github.com/BGI-flexlab/SOAPnuke/ releases/tag/SOAPnuke2.1.7 Sentieon Genomics software (version: sentieon-genomics-202112) Freed et al.49 https://support.sentieon.com/versions/ 202112/manual/DNAseq_usage/dnaseq/ BWA MEM Li et al.50 https://arxiv.org/abs/1303.3997 Samtools Li et al.51 https://samtools.sourceforge.net/ Picard ‘‘Picard Toolkit.’’ 2019.

    Sequencing:

    Article Title: Unified framework for patient-derived, tumor-organoid-based predictive testing of standard-of-care therapies in metastatic colorectal cancer
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Ki67 antibody DAKO Cat#M7240, RRID: AB_2142367 Mouse anti-MUC2 antibody Santa Cruz Biotechnology Cat#sc-7314, RRID: AB_627970 Mouse anti-p53 antibody Santa Cruz Biotechnology Cat#sc-126, RRID: AB_628082 Biological samples Human colorectal cancer tissues This paper N/A Human normal colon tissues This paper N/A Buffy coat from patient blood samples This paper N/A Chemicals, peptides, and recombinant proteins GlutaMax supplement Gibco Cat#35050061 HEPES Sigma-Aldrich Cat#H3375-1KG B-27 supplement Life Technologies Cat#17504001 N2 supplement Life Technologies Cat#17502001 Nicotinamide Sigma-Aldrich Cat#72340-1KG N-acetyl-L-cysteine Sigma-Aldrich Cat#A7250-1KG Recombinant human basic FGF Life Technologies Cat#PHG0263 Recombinant human EGF Life Technologies Cat#PHG0313 A83-01 Tocris Bioscience Cat#2939 Primocin Invivogen Cat#ant-pm-2 Y27632 Stemcell Technologies Cat#72308 Matrigel Corning Cat#356234 Penicillin-streptomycin Life Technologies Cat#15140122 Normocin Invivogen Catant-nr-2 Dispase II Life Technologies Cat#17105-041 Collagenase IV Life Technologies Cat#17104019 TrypLE Express enzyme Thermo Fisher Scientific Cat#12604021 Tissue-Tek O.C.T Compound Emgrid Cat#4583 HistoGel Themo Fisher Scientific Cat#22-110-678 Critical commercial assays ISOLATE II Genomic DNA Kit Bioline Cat#BIO-52067 DIPSEQ platform (BGI) BGI N/A MGIEasy Universal DNA Library Prep Set MGI Cat#1000006986 LookOut Mycoplasma PCR Detection Kit Sigma-Aldrich MP0035-1KT Dako Omnis platform Agilent N/A Deposited data Whole genome sequencing data This paper; The CNGB Sequence Archive (CNSA) of China National GeneBank DataBase (CNGBdb) Accession numbers of whole-genome sequencing data in CNGBdb: CNP0001424 and CNP0003751 (https://db.cngb.org/cnsa/) hg38 GCA_000001405.15_GRCh38_no_ alt_analysis_set.fna downloaded from HMFTools-Resources https://nextcloud.hartwigmedicalfoundation. nl/s/LTiKTd8XxBqwaiC?path = %2 FHMFTools-Resources Experimental models: Organisms/strains Patient-derived colorectal cancer organoids This paper N/A (Continued on next page) e1 Cell Reports Medicine 4, 101335, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms SOAPnuke (v2.1.7) Chen et al.48 https://github.com/BGI-flexlab/SOAPnuke/ releases/tag/SOAPnuke2.1.7 Sentieon Genomics software (version: sentieon-genomics-202112) Freed et al.49 https://support.sentieon.com/versions/ 202112/manual/DNAseq_usage/dnaseq/ BWA MEM Li et al.50 https://arxiv.org/abs/1303.3997 Samtools Li et al.51 https://samtools.sourceforge.net/ Picard ‘‘Picard Toolkit.’’ 2019.



    Similar Products

    99
    InvivoGen normocin invivogen cat
    Normocin Invivogen Cat, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Normocin/pm42213779-414-98-99
    Average 99 stars, based on 1 article reviews
    normocin invivogen cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    InvivoGen normocin
    Normocin, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Normocin/custom%40ant-nr-05%4042411568
    Average 99 stars, based on 1 article reviews
    normocin - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    InvivoGen resource source identifier normocin invivogen cat
    Resource Source Identifier Normocin Invivogen Cat, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Normocin/pm40803321-1327-2-6
    Average 99 stars, based on 1 article reviews
    resource source identifier normocin invivogen cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    InvivoGen 250g f normocin invivogen cat
    250g F Normocin Invivogen Cat, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Normocin/pm40317722-70-83-85
    Average 99 stars, based on 1 article reviews
    250g f normocin invivogen cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    InvivoGen normocintm invivogen cat
    Normocintm Invivogen Cat, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Normocin/pm40215166-651-117-118
    Average 99 stars, based on 1 article reviews
    normocintm invivogen cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    InvivoGen p36930 normocin invivogen cat
    P36930 Normocin Invivogen Cat, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normocin+invivogen+cat/Blasticidin/pm39541970-206-99-101
    Average 99 stars, based on 1 article reviews
    p36930 normocin invivogen cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results